BMRB Entry 50571
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50571
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: PfAlu RNA Helix4 PubMed: 34017052
Deposition date: 2020-11-12 Original release date: 2021-05-11
Authors: Soni, Komal; Sinning, Irmgard
Citation: Soni, Komal; Kempf, Georg; Manalastas-Cantos, Karen; Hendricks, Astrid; Flemming, Dirk; Guizetti, Julien; Simon, Bernd; Frischknecht, Friedrich; Svergun, Dmitri; Wild, Klemens; Sinning, Irmgard. "Structural analysis of the SRP Alu domain from Plasmodium falciparum reveals a non-canonical open conformation" Commun. Biol. 4, 600-600 (2021).
Assembly members:
entity_1, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Plasmodium falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCAUUCUUGGGACUGCAU
UUCGAUGCAAAAGGAAUGCU
C
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 12 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | PfAlu Helix4 | 1 |
Entities:
Entity 1, PfAlu Helix4 41 residues - Formula weight is not available
1 | G | G | G | C | A | U | U | C | U | U | ||||
2 | G | G | G | A | C | U | G | C | A | U | ||||
3 | U | U | C | G | A | U | G | C | A | A | ||||
4 | A | A | G | G | A | A | U | G | C | U | ||||
5 | C |
Samples:
sample_1: PfAlu Helix4 275 uM; sodium phosphate 20 mM
sample_conditions_1: pH: 6.8; pressure: 1 atm; temperature: 277 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
CcpNMR - chemical shift assignment
NMR spectrometers:
- Bruker AVANCE III 700 MHz