data_30797 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30797 _Entry.Title ; Dengue 5'UTR SLA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-09-15 _Entry.Accession_date 2020-09-15 _Entry.Last_release_date 2020-09-29 _Entry.Original_release_date 2020-09-29 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Y. Sun Y. T. . . 30797 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 5'-UTR . 30797 Denv1 . 30797 RNA . 30797 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30797 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 126 30797 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2021-09-22 . original BMRB . 30797 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7K4L 'BMRB Entry Tracking System' 30797 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30797 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution NMR Structure of Denv1 5'UTR SLA region ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Y. Sun Y. T. . . 30797 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30797 _Assembly.ID 1 _Assembly.Name 'DenvSLA RNA' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 30797 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30797 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGUGGUUAGUCUACGUUU CGACGUAGUUCUAACC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 36 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 11521.802 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 30797 1 2 . G . 30797 1 3 . A . 30797 1 4 . G . 30797 1 5 . U . 30797 1 6 . G . 30797 1 7 . G . 30797 1 8 . U . 30797 1 9 . U . 30797 1 10 . A . 30797 1 11 . G . 30797 1 12 . U . 30797 1 13 . C . 30797 1 14 . U . 30797 1 15 . A . 30797 1 16 . C . 30797 1 17 . G . 30797 1 18 . U . 30797 1 19 . U . 30797 1 20 . U . 30797 1 21 . C . 30797 1 22 . G . 30797 1 23 . A . 30797 1 24 . C . 30797 1 25 . G . 30797 1 26 . U . 30797 1 27 . A . 30797 1 28 . G . 30797 1 29 . U . 30797 1 30 . U . 30797 1 31 . C . 30797 1 32 . U . 30797 1 33 . A . 30797 1 34 . A . 30797 1 35 . C . 30797 1 36 . C . 30797 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 30797 1 . G 2 2 30797 1 . A 3 3 30797 1 . G 4 4 30797 1 . U 5 5 30797 1 . G 6 6 30797 1 . G 7 7 30797 1 . U 8 8 30797 1 . U 9 9 30797 1 . A 10 10 30797 1 . G 11 11 30797 1 . U 12 12 30797 1 . C 13 13 30797 1 . U 14 14 30797 1 . A 15 15 30797 1 . C 16 16 30797 1 . G 17 17 30797 1 . U 18 18 30797 1 . U 19 19 30797 1 . U 20 20 30797 1 . C 21 21 30797 1 . G 22 22 30797 1 . A 23 23 30797 1 . C 24 24 30797 1 . G 25 25 30797 1 . U 26 26 30797 1 . A 27 27 30797 1 . G 28 28 30797 1 . U 29 29 30797 1 . U 30 30 30797 1 . C 31 31 30797 1 . U 32 32 30797 1 . A 33 33 30797 1 . A 34 34 30797 1 . C 35 35 30797 1 . C 36 36 30797 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30797 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 10760 organism . 'Escherichia phage T7' 'Escherichia phage T7' . . Viruses . Teseptimavirus 'Escherichia virus T7' . . . . . . . . . . . . . 30797 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30797 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30797 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30797 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '200 uM DenvSLA, 10 mM potassium phosphate, 10 mM potassium chloride, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 DenvSLA 'natural abundance' . . 1 $entity_1 . . 200 . . uM . . . . 30797 1 2 'potassium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 30797 1 3 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 30797 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 30797 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '200 uM [U-100% 2H] DenvSLA, 10 mM potassium phosphate, 10 mM potassium chloride, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 DenvSLA '[U-100% 2H]' . . 1 $entity_1 . . 200 . . uM . . . . 30797 2 2 'potassium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 30797 2 3 'potassium chloride' 'natural abundance' . . . . . . 10 . . mM . . . . 30797 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30797 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 40 . mM 30797 1 pH 6.5 . pH 30797 1 pressure 1 . atm 30797 1 temperature 298 . K 30797 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30797 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 30797 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 30797 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30797 _Software.ID 2 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30797 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30797 2 'structure calculation' . 30797 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 30797 _Software.ID 3 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee W, Tonelli M, Markley JL' . . 30797 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 30797 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30797 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE II' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 30797 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE II' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 500 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30797 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE II' . 600 . . . 30797 1 2 NMR_spectrometer_2 Bruker 'AVANCE II' . 500 . . . 30797 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30797 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30797 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30797 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 30797 1 4 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 30797 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30797 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 30797 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30797 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H TOCSY' . . . 30797 1 2 '2D 1H-1H NOESY' . . . 30797 1 3 '2D 1H-1H NOESY' . . . 30797 1 4 '2D 1H-1H TOCSY' . . . 30797 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 5 5 U H1' H 1 5.742 0.00 . . . . . . A 5 U H1' . 30797 1 2 . 1 . 1 5 5 U H5 H 1 5.626 0.00 . . . . . . A 5 U H5 . 30797 1 3 . 1 . 1 5 5 U H6 H 1 7.762 0.00 . . . . . . A 5 U H6 . 30797 1 4 . 1 . 1 5 5 U HO2' H 1 4.375 0.00 . . . . . . A 5 U HO2' . 30797 1 5 . 1 . 1 6 6 G H1' H 1 5.749 0.00 . . . . . . A 6 G H1' . 30797 1 6 . 1 . 1 6 6 G H8 H 1 8.022 0.00 . . . . . . A 6 G H8 . 30797 1 7 . 1 . 1 6 6 G HO2' H 1 4.912 0.00 . . . . . . A 6 G HO2' . 30797 1 8 . 1 . 1 7 7 G H1' H 1 5.829 0.00 . . . . . . A 7 G H1' . 30797 1 9 . 1 . 1 7 7 G H8 H 1 7.523 0.00 . . . . . . A 7 G H8 . 30797 1 10 . 1 . 1 7 7 G HO2' H 1 4.571 0.00 . . . . . . A 7 G HO2' . 30797 1 11 . 1 . 1 8 8 U H1' H 1 5.548 0.00 . . . . . . A 8 U H1' . 30797 1 12 . 1 . 1 8 8 U H5 H 1 5.100 0.00 . . . . . . A 8 U H5 . 30797 1 13 . 1 . 1 8 8 U H6 H 1 7.744 0.00 . . . . . . A 8 U H6 . 30797 1 14 . 1 . 1 8 8 U HO2' H 1 4.495 0.00 . . . . . . A 8 U HO2' . 30797 1 15 . 1 . 1 9 9 U H1' H 1 5.579 0.00 . . . . . . A 9 U H1' . 30797 1 16 . 1 . 1 9 9 U H5 H 1 5.599 0.00 . . . . . . A 9 U H5 . 30797 1 17 . 1 . 1 9 9 U H6 H 1 7.926 0.00 . . . . . . A 9 U H6 . 30797 1 18 . 1 . 1 9 9 U HO2' H 1 4.467 0.00 . . . . . . A 9 U HO2' . 30797 1 19 . 1 . 1 10 10 A H1' H 1 5.968 0.00 . . . . . . A 10 A H1' . 30797 1 20 . 1 . 1 10 10 A H8 H 1 8.125 0.00 . . . . . . A 10 A H8 . 30797 1 21 . 1 . 1 10 10 A HO2' H 1 4.680 0.00 . . . . . . A 10 A HO2' . 30797 1 22 . 1 . 1 11 11 G H1' H 1 5.410 0.00 . . . . . . A 11 G H1' . 30797 1 23 . 1 . 1 11 11 G H8 H 1 6.980 0.00 . . . . . . A 11 G H8 . 30797 1 24 . 1 . 1 11 11 G HO2' H 1 4.485 0.00 . . . . . . A 11 G HO2' . 30797 1 25 . 1 . 1 12 12 U H1' H 1 5.344 0.00 . . . . . . A 12 U H1' . 30797 1 26 . 1 . 1 12 12 U H3' H 1 4.378 0.00 . . . . . . A 12 U H3' . 30797 1 27 . 1 . 1 12 12 U H4' H 1 4.483 0.00 . . . . . . A 12 U H4' . 30797 1 28 . 1 . 1 12 12 U H5 H 1 5.191 0.00 . . . . . . A 12 U H5 . 30797 1 29 . 1 . 1 12 12 U H6 H 1 7.503 0.00 . . . . . . A 12 U H6 . 30797 1 30 . 1 . 1 12 12 U HO2' H 1 4.263 0.00 . . . . . . A 12 U HO2' . 30797 1 31 . 1 . 1 13 13 C H1' H 1 5.461 0.00 . . . . . . A 13 C H1' . 30797 1 32 . 1 . 1 13 13 C H5 H 1 5.635 0.00 . . . . . . A 13 C H5 . 30797 1 33 . 1 . 1 13 13 C H6 H 1 7.991 0.00 . . . . . . A 13 C H6 . 30797 1 34 . 1 . 1 13 13 C HO2' H 1 4.264 0.00 . . . . . . A 13 C HO2' . 30797 1 35 . 1 . 1 14 14 U H1' H 1 5.509 0.00 . . . . . . A 14 U H1' . 30797 1 36 . 1 . 1 14 14 U H5 H 1 5.546 0.00 . . . . . . A 14 U H5 . 30797 1 37 . 1 . 1 14 14 U H6 H 1 8.003 0.00 . . . . . . A 14 U H6 . 30797 1 38 . 1 . 1 14 14 U HO2' H 1 4.537 0.00 . . . . . . A 14 U HO2' . 30797 1 39 . 1 . 1 15 15 A H1' H 1 6.031 0.00 . . . . . . A 15 A H1' . 30797 1 40 . 1 . 1 15 15 A H8 H 1 8.189 0.00 . . . . . . A 15 A H8 . 30797 1 41 . 1 . 1 15 15 A HO2' H 1 4.466 0.00 . . . . . . A 15 A HO2' . 30797 1 42 . 1 . 1 16 16 C H1' H 1 5.388 0.00 . . . . . . A 16 C H1' . 30797 1 43 . 1 . 1 16 16 C H5 H 1 5.183 0.00 . . . . . . A 16 C H5 . 30797 1 44 . 1 . 1 16 16 C H6 H 1 7.482 0.00 . . . . . . A 16 C H6 . 30797 1 45 . 1 . 1 16 16 C HO2' H 1 4.358 0.00 . . . . . . A 16 C HO2' . 30797 1 46 . 1 . 1 17 17 G H1' H 1 5.699 0.00 . . . . . . A 17 G H1' . 30797 1 47 . 1 . 1 17 17 G H8 H 1 7.475 0.00 . . . . . . A 17 G H8 . 30797 1 48 . 1 . 1 17 17 G HO2' H 1 4.477 0.00 . . . . . . A 17 G HO2' . 30797 1 49 . 1 . 1 18 18 U H1' H 1 5.561 0.00 . . . . . . A 18 U H1' . 30797 1 50 . 1 . 1 18 18 U H3' H 1 4.316 0.00 . . . . . . A 18 U H3' . 30797 1 51 . 1 . 1 18 18 U H5 H 1 5.033 0.00 . . . . . . A 18 U H5 . 30797 1 52 . 1 . 1 18 18 U H6 H 1 7.556 0.00 . . . . . . A 18 U H6 . 30797 1 53 . 1 . 1 18 18 U HO2' H 1 4.512 0.00 . . . . . . A 18 U HO2' . 30797 1 54 . 1 . 1 19 19 U H1' H 1 5.376 0.00 . . . . . . A 19 U H1' . 30797 1 55 . 1 . 1 19 19 U H3' H 1 4.511 0.00 . . . . . . A 19 U H3' . 30797 1 56 . 1 . 1 19 19 U H4' H 1 4.405 0.00 . . . . . . A 19 U H4' . 30797 1 57 . 1 . 1 19 19 U H5 H 1 5.785 0.00 . . . . . . A 19 U H5 . 30797 1 58 . 1 . 1 19 19 U H5' H 1 4.484 0.00 . . . . . . A 19 U H5' . 30797 1 59 . 1 . 1 19 19 U H6 H 1 7.770 0.00 . . . . . . A 19 U H6 . 30797 1 60 . 1 . 1 19 19 U HO2' H 1 3.781 0.00 . . . . . . A 19 U HO2' . 30797 1 61 . 1 . 1 20 20 U H1' H 1 6.086 0.00 . . . . . . A 20 U H1' . 30797 1 62 . 1 . 1 20 20 U H3' H 1 4.016 0.00 . . . . . . A 20 U H3' . 30797 1 63 . 1 . 1 20 20 U H4' H 1 4.475 0.00 . . . . . . A 20 U H4' . 30797 1 64 . 1 . 1 20 20 U H5 H 1 5.865 0.00 . . . . . . A 20 U H5 . 30797 1 65 . 1 . 1 20 20 U H6 H 1 8.015 0.00 . . . . . . A 20 U H6 . 30797 1 66 . 1 . 1 20 20 U HO2' H 1 4.681 0.00 . . . . . . A 20 U HO2' . 30797 1 67 . 1 . 1 21 21 C H1' H 1 5.904 0.00 . . . . . . A 21 C H1' . 30797 1 68 . 1 . 1 21 21 C H3' H 1 4.379 0.00 . . . . . . A 21 C H3' . 30797 1 69 . 1 . 1 21 21 C H4' H 1 3.724 0.00 . . . . . . A 21 C H4' . 30797 1 70 . 1 . 1 21 21 C H5 H 1 6.124 0.00 . . . . . . A 21 C H5 . 30797 1 71 . 1 . 1 21 21 C H6 H 1 7.667 0.00 . . . . . . A 21 C H6 . 30797 1 72 . 1 . 1 21 21 C HO2' H 1 4.082 0.00 . . . . . . A 21 C HO2' . 30797 1 73 . 1 . 1 22 22 G H1' H 1 5.939 0.00 . . . . . . A 22 G H1' . 30797 1 74 . 1 . 1 22 22 G H3' H 1 5.611 0.00 . . . . . . A 22 G H3' . 30797 1 75 . 1 . 1 22 22 G H4' H 1 4.399 0.00 . . . . . . A 22 G H4' . 30797 1 76 . 1 . 1 22 22 G H8 H 1 7.848 0.00 . . . . . . A 22 G H8 . 30797 1 77 . 1 . 1 22 22 G HO2' H 1 4.862 0.00 . . . . . . A 22 G HO2' . 30797 1 78 . 1 . 1 23 23 A H8 H 1 8.561 0.00 . . . . . . A 23 A H8 . 30797 1 79 . 1 . 1 23 23 A HO2' H 1 4.510 0.00 . . . . . . A 23 A HO2' . 30797 1 80 . 1 . 1 24 24 C H1' H 1 5.411 0.00 . . . . . . A 24 C H1' . 30797 1 81 . 1 . 1 24 24 C H5 H 1 5.187 0.00 . . . . . . A 24 C H5 . 30797 1 82 . 1 . 1 24 24 C H6 H 1 7.350 0.00 . . . . . . A 24 C H6 . 30797 1 83 . 1 . 1 24 24 C HO2' H 1 4.497 0.00 . . . . . . A 24 C HO2' . 30797 1 84 . 1 . 1 25 25 G H1' H 1 5.731 0.00 . . . . . . A 25 G H1' . 30797 1 85 . 1 . 1 25 25 G H8 H 1 7.520 0.00 . . . . . . A 25 G H8 . 30797 1 86 . 1 . 1 25 25 G HO2' H 1 4.516 0.00 . . . . . . A 25 G HO2' . 30797 1 87 . 1 . 1 26 26 U H1' H 1 5.478 0.00 . . . . . . A 26 U H1' . 30797 1 88 . 1 . 1 26 26 U H5 H 1 5.107 0.00 . . . . . . A 26 U H5 . 30797 1 89 . 1 . 1 26 26 U H6 H 1 7.689 0.00 . . . . . . A 26 U H6 . 30797 1 90 . 1 . 1 26 26 U HO2' H 1 4.608 0.00 . . . . . . A 26 U HO2' . 30797 1 91 . 1 . 1 27 27 A H1' H 1 5.907 0.00 . . . . . . A 27 A H1' . 30797 1 92 . 1 . 1 27 27 A H8 H 1 8.019 0.00 . . . . . . A 27 A H8 . 30797 1 93 . 1 . 1 27 27 A HO2' H 1 4.534 0.00 . . . . . . A 27 A HO2' . 30797 1 94 . 1 . 1 28 28 G H1' H 1 5.692 0.00 . . . . . . A 28 G H1' . 30797 1 95 . 1 . 1 28 28 G H8 H 1 7.288 0.00 . . . . . . A 28 G H8 . 30797 1 96 . 1 . 1 28 28 G HO2' H 1 4.279 0.00 . . . . . . A 28 G HO2' . 30797 1 97 . 1 . 1 29 29 U H1' H 1 5.903 0.00 . . . . . . A 29 U H1' . 30797 1 98 . 1 . 1 29 29 U H5 H 1 5.843 0.00 . . . . . . A 29 U H5 . 30797 1 99 . 1 . 1 29 29 U H6 H 1 7.863 0.00 . . . . . . A 29 U H6 . 30797 1 100 . 1 . 1 29 29 U HO2' H 1 4.381 0.00 . . . . . . A 29 U HO2' . 30797 1 101 . 1 . 1 30 30 U H1' H 1 5.605 0.00 . . . . . . A 30 U H1' . 30797 1 102 . 1 . 1 30 30 U H3' H 1 4.449 0.00 . . . . . . A 30 U H3' . 30797 1 103 . 1 . 1 30 30 U H5 H 1 5.302 0.00 . . . . . . A 30 U H5 . 30797 1 104 . 1 . 1 30 30 U H6 H 1 7.851 0.00 . . . . . . A 30 U H6 . 30797 1 105 . 1 . 1 30 30 U HO2' H 1 4.519 0.00 . . . . . . A 30 U HO2' . 30797 1 106 . 1 . 1 31 31 C H1' H 1 5.668 0.00 . . . . . . A 31 C H1' . 30797 1 107 . 1 . 1 31 31 C H5 H 1 5.857 0.00 . . . . . . A 31 C H5 . 30797 1 108 . 1 . 1 31 31 C H6 H 1 7.973 0.00 . . . . . . A 31 C H6 . 30797 1 109 . 1 . 1 31 31 C HO2' H 1 4.424 0.00 . . . . . . A 31 C HO2' . 30797 1 110 . 1 . 1 32 32 U H1' H 1 5.523 0.00 . . . . . . A 32 U H1' . 30797 1 111 . 1 . 1 32 32 U H5 H 1 5.514 0.00 . . . . . . A 32 U H5 . 30797 1 112 . 1 . 1 32 32 U H6 H 1 7.806 0.00 . . . . . . A 32 U H6 . 30797 1 113 . 1 . 1 32 32 U HO2' H 1 4.633 0.00 . . . . . . A 32 U HO2' . 30797 1 114 . 1 . 1 33 33 A H1' H 1 5.929 0.00 . . . . . . A 33 A H1' . 30797 1 115 . 1 . 1 33 33 A H8 H 1 8.209 0.00 . . . . . . A 33 A H8 . 30797 1 116 . 1 . 1 33 33 A HO2' H 1 4.532 0.00 . . . . . . A 33 A HO2' . 30797 1 117 . 1 . 1 34 34 A H1' H 1 5.863 0.00 . . . . . . A 34 A H1' . 30797 1 118 . 1 . 1 34 34 A H8 H 1 7.897 0.00 . . . . . . A 34 A H8 . 30797 1 119 . 1 . 1 34 34 A HO2' H 1 4.430 0.00 . . . . . . A 34 A HO2' . 30797 1 120 . 1 . 1 35 35 C H1' H 1 5.337 0.01 . . . . . . A 35 C H1' . 30797 1 121 . 1 . 1 35 35 C H5 H 1 5.139 0.00 . . . . . . A 35 C H5 . 30797 1 122 . 1 . 1 35 35 C H6 H 1 7.436 0.00 . . . . . . A 35 C H6 . 30797 1 123 . 1 . 1 35 35 C HO2' H 1 4.060 0.01 . . . . . . A 35 C HO2' . 30797 1 124 . 1 . 1 36 36 C H1' H 1 5.763 0.00 . . . . . . A 36 C H1' . 30797 1 125 . 1 . 1 36 36 C H5 H 1 5.445 0.00 . . . . . . A 36 C H5 . 30797 1 126 . 1 . 1 36 36 C H6 H 1 7.619 0.00 . . . . . . A 36 C H6 . 30797 1 stop_ save_