data_30803 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30803 _Entry.Title ; Solution structure of the major MYC promoter G-quadruplex with a wild-type flanking sequence ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-10-03 _Entry.Accession_date 2020-10-03 _Entry.Last_release_date 2020-10-07 _Entry.Original_release_date 2020-10-07 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 J. Dickerhoff J. . . . 30803 2 D. Yang D. . . . 30803 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 30803 'DRUG-DNA COMPLEX' . 30803 'G-QUADRUPLEX DNA' . 30803 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30803 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 26 30803 '1H chemical shifts' 208 30803 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2021-06-18 . original BMRB . 30803 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 30804 'major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative' 30803 BMRB 30805 'major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative' 30803 PDB 7KBV 'major MYC promoter G-quadruplex with a wild-type flanking sequence' 30803 PDB 7KBW 'major MYC promoter G-quadruplex with a wild-type flanking in complex with NSC85697, a quinoline derivative' 30803 PDB 7KBX 'major MYC promoter G-quadruplex in complex with NSC85697, a quinoline derivative' 30803 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30803 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 33978746 _Citation.DOI 10.1093/nar/gkab330 _Citation.Full_citation . _Citation.Title ; Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 49 _Citation.Journal_issue 10 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 5905 _Citation.Page_last 5915 _Citation.Year 2021 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Jonathan Dickerhoff J. . . . 30803 1 2 Jixun Dai J. . . . 30803 1 3 Danzhou Yang D. . . . 30803 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30803 _Assembly.ID 1 _Assembly.Name Myc2345 _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 30803 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30803 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; TGAGGGTGGGTAGGGTGGGG AA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7033.523 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 4 DT . 30803 1 2 5 DG . 30803 1 3 6 DA . 30803 1 4 7 DG . 30803 1 5 8 DG . 30803 1 6 9 DG . 30803 1 7 10 DT . 30803 1 8 11 DG . 30803 1 9 12 DG . 30803 1 10 13 DG . 30803 1 11 14 DT . 30803 1 12 15 DA . 30803 1 13 16 DG . 30803 1 14 17 DG . 30803 1 15 18 DG . 30803 1 16 19 DT . 30803 1 17 20 DG . 30803 1 18 21 DG . 30803 1 19 22 DG . 30803 1 20 23 DG . 30803 1 21 24 DA . 30803 1 22 25 DA . 30803 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DT 1 1 30803 1 . DG 2 2 30803 1 . DA 3 3 30803 1 . DG 4 4 30803 1 . DG 5 5 30803 1 . DG 6 6 30803 1 . DT 7 7 30803 1 . DG 8 8 30803 1 . DG 9 9 30803 1 . DG 10 10 30803 1 . DT 11 11 30803 1 . DA 12 12 30803 1 . DG 13 13 30803 1 . DG 14 14 30803 1 . DG 15 15 30803 1 . DT 16 16 30803 1 . DG 17 17 30803 1 . DG 18 18 30803 1 . DG 19 19 30803 1 . DG 20 20 30803 1 . DA 21 21 30803 1 . DA 22 22 30803 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30803 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 30803 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30803 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30803 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30803 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.4 mM Myc2345, 10 mM potassium phosphate, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 Myc2345 'natural abundance' . . 1 $entity_1 . . 1.4 . . mM . . . . 30803 1 2 'potassium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 30803 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30803 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 30803 1 pH 7 . pH 30803 1 pressure 1 . atm 30803 1 temperature 298 . K 30803 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 30803 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 30803 2 pH 7 . pH 30803 2 pressure 1 . atm 30803 2 temperature 313 . K 30803 2 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 30803 _Sample_condition_list.ID 3 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 30803 3 pH 7 . pH 30803 3 pressure 1 . atm 30803 3 temperature 308 . K 30803 3 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30803 _Software.ID 1 _Software.Type . _Software.Name Amber _Software.Version 16 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman' . . 30803 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30803 1 'structure calculation' . 30803 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30803 _Software.ID 2 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version 2.48 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30803 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 30803 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 30803 _Software.ID 3 _Software.Type . _Software.Name 'CcpNmr Analysis' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID CCPN . . 30803 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 30803 3 'peak picking' . 30803 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30803 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30803 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE III' . 800 . . . 30803 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30803 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30803 1 2 '2D NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30803 1 3 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30803 1 4 '2D DQF-COSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 3 $sample_conditions_3 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30803 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30803 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.000 internal indirect 0.251449530 . . . . . 30803 1 H 1 water protons . . . . ppm 4.78 internal direct 1.0 . . . . . 30803 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30803 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D NOESY' . . . 30803 1 2 '2D NOESY' . . . 30803 1 3 '2D 1H-13C HSQC aromatic' . . . 30803 1 4 '2D DQF-COSY' . . . 30803 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DT H1' H 1 5.798 0.003 . 1 . . 548 . A 4 DT H1' . 30803 1 2 . 1 . 1 1 1 DT H2' H 1 1.629 0.002 . 1 . . 550 . A 4 DT H2' . 30803 1 3 . 1 . 1 1 1 DT H2'' H 1 2.052 0.003 . 1 . . 549 . A 4 DT H2'' . 30803 1 4 . 1 . 1 1 1 DT H3' H 1 4.439 0.006 . 1 . . 656 . A 4 DT H3' . 30803 1 5 . 1 . 1 1 1 DT H4' H 1 3.817 0.003 . 1 . . 680 . A 4 DT H4' . 30803 1 6 . 1 . 1 1 1 DT H5' H 1 3.481 0.001 . 2 . . 681 . A 4 DT H5' . 30803 1 7 . 1 . 1 1 1 DT H5'' H 1 3.484 0.005 . 2 . . 682 . A 4 DT H5'' . 30803 1 8 . 1 . 1 1 1 DT H6 H 1 7.219 0.001 . 1 . . 547 . A 4 DT H6 . 30803 1 9 . 1 . 1 1 1 DT H71 H 1 1.666 0.003 . 1 . . 551 . A 4 DT H71 . 30803 1 10 . 1 . 1 1 1 DT H72 H 1 1.666 0.003 . 1 . . 551 . A 4 DT H72 . 30803 1 11 . 1 . 1 1 1 DT H73 H 1 1.666 0.003 . 1 . . 551 . A 4 DT H73 . 30803 1 12 . 1 . 1 1 1 DT C6 C 13 139.853 . . 1 . . 552 . A 4 DT C6 . 30803 1 13 . 1 . 1 2 2 DG H1' H 1 5.679 0.004 . 1 . . 554 . A 5 DG H1' . 30803 1 14 . 1 . 1 2 2 DG H2' H 1 2.537 0.004 . 1 . . 556 . A 5 DG H2' . 30803 1 15 . 1 . 1 2 2 DG H2'' H 1 2.402 0.003 . 1 . . 555 . A 5 DG H2'' . 30803 1 16 . 1 . 1 2 2 DG H3' H 1 4.721 0.003 . 1 . . 657 . A 5 DG H3' . 30803 1 17 . 1 . 1 2 2 DG H4' H 1 4.117 0.002 . 1 . . 683 . A 5 DG H4' . 30803 1 18 . 1 . 1 2 2 DG H5' H 1 3.737 0.002 . 2 . . 684 . A 5 DG H5' . 30803 1 19 . 1 . 1 2 2 DG H5'' H 1 3.828 0.002 . 2 . . 685 . A 5 DG H5'' . 30803 1 20 . 1 . 1 2 2 DG H8 H 1 7.651 0.002 . 1 . . 553 . A 5 DG H8 . 30803 1 21 . 1 . 1 2 2 DG C8 C 13 139.706 . . 1 . . 557 . A 5 DG C8 . 30803 1 22 . 1 . 1 3 3 DA H1' H 1 5.888 0.004 . 1 . . 562 . A 6 DA H1' . 30803 1 23 . 1 . 1 3 3 DA H2 H 1 7.778 0.003 . 1 . . 648 . A 6 DA H2 . 30803 1 24 . 1 . 1 3 3 DA H2' H 1 2.390 0.002 . 1 . . 561 . A 6 DA H2' . 30803 1 25 . 1 . 1 3 3 DA H2'' H 1 2.569 0.003 . 1 . . 560 . A 6 DA H2'' . 30803 1 26 . 1 . 1 3 3 DA H3' H 1 4.838 0.004 . 1 . . 658 . A 6 DA H3' . 30803 1 27 . 1 . 1 3 3 DA H4' H 1 4.006 0.004 . 1 . . 704 . A 6 DA H4' . 30803 1 28 . 1 . 1 3 3 DA H5' H 1 3.847 0.002 . 2 . . 705 . A 6 DA H5' . 30803 1 29 . 1 . 1 3 3 DA H5'' H 1 3.627 0.002 . 2 . . 706 . A 6 DA H5'' . 30803 1 30 . 1 . 1 3 3 DA H8 H 1 7.971 0.001 . 1 . . 558 . A 6 DA H8 . 30803 1 31 . 1 . 1 3 3 DA C2 C 13 155.053 . . 1 . . 649 . A 6 DA C2 . 30803 1 32 . 1 . 1 3 3 DA C8 C 13 141.611 . . 1 . . 559 . A 6 DA C8 . 30803 1 33 . 1 . 1 4 4 DG H1 H 1 11.728 0.002 . 1 . . 641 . A 7 DG H1 . 30803 1 34 . 1 . 1 4 4 DG H1' H 1 6.115 0.001 . 1 . . 566 . A 7 DG H1' . 30803 1 35 . 1 . 1 4 4 DG H2' H 1 2.789 0.001 . 1 . . 568 . A 7 DG H2' . 30803 1 36 . 1 . 1 4 4 DG H2'' H 1 3.072 0.001 . 1 . . 567 . A 7 DG H2'' . 30803 1 37 . 1 . 1 4 4 DG H3' H 1 4.999 0.003 . 1 . . 659 . A 7 DG H3' . 30803 1 38 . 1 . 1 4 4 DG H4' H 1 4.469 0.005 . 1 . . 696 . A 7 DG H4' . 30803 1 39 . 1 . 1 4 4 DG H5' H 1 4.117 0.001 . 2 . . 694 . A 7 DG H5' . 30803 1 40 . 1 . 1 4 4 DG H5'' H 1 4.031 0.004 . 2 . . 695 . A 7 DG H5'' . 30803 1 41 . 1 . 1 4 4 DG H8 H 1 8.053 0.001 . 1 . . 563 . A 7 DG H8 . 30803 1 42 . 1 . 1 4 4 DG C8 C 13 138.212 . . 1 . . 565 . A 7 DG C8 . 30803 1 43 . 1 . 1 5 5 DG H1 H 1 11.227 0.003 . 1 . . 642 . A 8 DG H1 . 30803 1 44 . 1 . 1 5 5 DG H1' H 1 6.110 0.002 . 1 . . 570 . A 8 DG H1' . 30803 1 45 . 1 . 1 5 5 DG H2' H 1 2.586 0.002 . 1 . . 571 . A 8 DG H2' . 30803 1 46 . 1 . 1 5 5 DG H2'' H 1 2.857 0.002 . 1 . . 572 . A 8 DG H2'' . 30803 1 47 . 1 . 1 5 5 DG H3' H 1 5.011 0.005 . 1 . . 660 . A 8 DG H3' . 30803 1 48 . 1 . 1 5 5 DG H4' H 1 4.515 0.002 . 1 . . 751 . A 8 DG H4' . 30803 1 49 . 1 . 1 5 5 DG H5' H 1 4.310 . . 2 . . 752 . A 8 DG H5' . 30803 1 50 . 1 . 1 5 5 DG H5'' H 1 4.284 . . 2 . . 753 . A 8 DG H5'' . 30803 1 51 . 1 . 1 5 5 DG H8 H 1 7.644 0.001 . 1 . . 569 . A 8 DG H8 . 30803 1 52 . 1 . 1 5 5 DG C8 C 13 137.640 . . 1 . . 573 . A 8 DG C8 . 30803 1 53 . 1 . 1 6 6 DG H1 H 1 10.871 0.002 . 1 . . 643 . A 9 DG H1 . 30803 1 54 . 1 . 1 6 6 DG H1' H 1 6.362 0.001 . 1 . . 575 . A 9 DG H1' . 30803 1 55 . 1 . 1 6 6 DG H2' H 1 2.696 0.001 . 1 . . 576 . A 9 DG H2' . 30803 1 56 . 1 . 1 6 6 DG H2'' H 1 2.672 0.001 . 1 . . 577 . A 9 DG H2'' . 30803 1 57 . 1 . 1 6 6 DG H3' H 1 5.157 0.0 . 1 . . 661 . A 9 DG H3' . 30803 1 58 . 1 . 1 6 6 DG H4' H 1 4.577 0.003 . 1 . . 679 . A 9 DG H4' . 30803 1 59 . 1 . 1 6 6 DG H5' H 1 4.357 0.002 . 2 . . 719 . A 9 DG H5' . 30803 1 60 . 1 . 1 6 6 DG H5'' H 1 4.298 0.003 . 2 . . 720 . A 9 DG H5'' . 30803 1 61 . 1 . 1 6 6 DG H8 H 1 7.415 0.001 . 1 . . 574 . A 9 DG H8 . 30803 1 62 . 1 . 1 6 6 DG C8 C 13 137.531 . . 1 . . 578 . A 9 DG C8 . 30803 1 63 . 1 . 1 7 7 DT H1' H 1 6.532 0.002 . 1 . . 740 . A 10 DT H1' . 30803 1 64 . 1 . 1 7 7 DT H2' H 1 2.485 0.001 . 1 . . 749 . A 10 DT H2' . 30803 1 65 . 1 . 1 7 7 DT H2'' H 1 2.678 0.003 . 1 . . 750 . A 10 DT H2'' . 30803 1 66 . 1 . 1 7 7 DT H3' H 1 5.109 0.001 . 1 . . 743 . A 10 DT H3' . 30803 1 67 . 1 . 1 7 7 DT H4' H 1 4.607 0.0 . 1 . . 744 . A 10 DT H4' . 30803 1 68 . 1 . 1 7 7 DT H5' H 1 4.297 0.001 . 2 . . 729 . A 10 DT H5' . 30803 1 69 . 1 . 1 7 7 DT H5'' H 1 4.357 0.002 . 2 . . 730 . A 10 DT H5'' . 30803 1 70 . 1 . 1 7 7 DT H6 H 1 7.866 0.001 . 1 . . 736 . A 10 DT H6 . 30803 1 71 . 1 . 1 7 7 DT H71 H 1 2.000 0.001 . 1 . . 746 . A 10 DT H71 . 30803 1 72 . 1 . 1 7 7 DT H72 H 1 2.000 0.001 . 1 . . 746 . A 10 DT H72 . 30803 1 73 . 1 . 1 7 7 DT H73 H 1 2.000 0.001 . 1 . . 746 . A 10 DT H73 . 30803 1 74 . 1 . 1 7 7 DT C6 C 13 140.238 . . 1 . . 737 . A 10 DT C6 . 30803 1 75 . 1 . 1 8 8 DG H1 H 1 11.732 0.004 . 1 . . 640 . A 11 DG H1 . 30803 1 76 . 1 . 1 8 8 DG H1' H 1 6.130 0.002 . 1 . . 614 . A 11 DG H1' . 30803 1 77 . 1 . 1 8 8 DG H2' H 1 2.457 0.001 . 1 . . 615 . A 11 DG H2' . 30803 1 78 . 1 . 1 8 8 DG H2'' H 1 2.896 0.002 . 1 . . 616 . A 11 DG H2'' . 30803 1 79 . 1 . 1 8 8 DG H3' H 1 5.108 0.002 . 1 . . 662 . A 11 DG H3' . 30803 1 80 . 1 . 1 8 8 DG H4' H 1 4.470 0.001 . 1 . . 703 . A 11 DG H4' . 30803 1 81 . 1 . 1 8 8 DG H5' H 1 4.341 . . 2 . . 724 . A 11 DG H5' . 30803 1 82 . 1 . 1 8 8 DG H5'' H 1 4.260 . . 2 . . 725 . A 11 DG H5'' . 30803 1 83 . 1 . 1 8 8 DG H8 H 1 7.967 0.001 . 1 . . 613 . A 11 DG H8 . 30803 1 84 . 1 . 1 8 8 DG C8 C 13 138.260 . . 1 . . 617 . A 11 DG C8 . 30803 1 85 . 1 . 1 9 9 DG H1 H 1 11.608 0.002 . 1 . . 639 . A 12 DG H1 . 30803 1 86 . 1 . 1 9 9 DG H1' H 1 6.164 0.001 . 1 . . 619 . A 12 DG H1' . 30803 1 87 . 1 . 1 9 9 DG H2' H 1 2.686 0.003 . 1 . . 620 . A 12 DG H2' . 30803 1 88 . 1 . 1 9 9 DG H2'' H 1 2.884 0.006 . 1 . . 621 . A 12 DG H2'' . 30803 1 89 . 1 . 1 9 9 DG H3' H 1 5.094 0.004 . 1 . . 663 . A 12 DG H3' . 30803 1 90 . 1 . 1 9 9 DG H4' H 1 4.483 0.003 . 1 . . 721 . A 12 DG H4' . 30803 1 91 . 1 . 1 9 9 DG H5' H 1 4.229 0.001 . 2 . . 722 . A 12 DG H5' . 30803 1 92 . 1 . 1 9 9 DG H5'' H 1 4.276 0.001 . 2 . . 723 . A 12 DG H5'' . 30803 1 93 . 1 . 1 9 9 DG H8 H 1 7.943 0.001 . 1 . . 618 . A 12 DG H8 . 30803 1 94 . 1 . 1 9 9 DG H21 H 1 9.461 . . 1 . . 764 . A 12 DG H21 . 30803 1 95 . 1 . 1 9 9 DG H22 H 1 6.439 . . 1 . . 763 . A 12 DG H22 . 30803 1 96 . 1 . 1 9 9 DG C8 C 13 138.712 . . 1 . . 622 . A 12 DG C8 . 30803 1 97 . 1 . 1 10 10 DG H1 H 1 11.376 0.002 . 1 . . 638 . A 13 DG H1 . 30803 1 98 . 1 . 1 10 10 DG H1' H 1 6.428 0.002 . 1 . . 625 . A 13 DG H1' . 30803 1 99 . 1 . 1 10 10 DG H2' H 1 2.716 . . 1 . . 627 . A 13 DG H2' . 30803 1 100 . 1 . 1 10 10 DG H2'' H 1 2.556 0.002 . 1 . . 626 . A 13 DG H2'' . 30803 1 101 . 1 . 1 10 10 DG H3' H 1 5.038 0.002 . 1 . . 664 . A 13 DG H3' . 30803 1 102 . 1 . 1 10 10 DG H4' H 1 4.488 0.003 . 1 . . 678 . A 13 DG H4' . 30803 1 103 . 1 . 1 10 10 DG H5' H 1 4.305 . . 2 . . 2093 . A 13 DG H5' . 30803 1 104 . 1 . 1 10 10 DG H5'' H 1 4.276 . . 2 . . 2094 . A 13 DG H5'' . 30803 1 105 . 1 . 1 10 10 DG H8 H 1 7.901 0.001 . 1 . . 623 . A 13 DG H8 . 30803 1 106 . 1 . 1 10 10 DG C8 C 13 138.511 . . 1 . . 624 . A 13 DG C8 . 30803 1 107 . 1 . 1 11 11 DT H1' H 1 6.235 0.002 . 1 . . 596 . A 14 DT H1' . 30803 1 108 . 1 . 1 11 11 DT H2' H 1 2.213 0.003 . 1 . . 598 . A 14 DT H2' . 30803 1 109 . 1 . 1 11 11 DT H2'' H 1 2.460 0.003 . 1 . . 597 . A 14 DT H2'' . 30803 1 110 . 1 . 1 11 11 DT H3' H 1 4.717 0.002 . 1 . . 665 . A 14 DT H3' . 30803 1 111 . 1 . 1 11 11 DT H4' H 1 3.883 0.003 . 1 . . 726 . A 14 DT H4' . 30803 1 112 . 1 . 1 11 11 DT H5' H 1 3.749 0.004 . 2 . . 754 . A 14 DT H5' . 30803 1 113 . 1 . 1 11 11 DT H5'' H 1 3.720 0.004 . 2 . . 755 . A 14 DT H5'' . 30803 1 114 . 1 . 1 11 11 DT H6 H 1 7.637 0.002 . 1 . . 594 . A 14 DT H6 . 30803 1 115 . 1 . 1 11 11 DT H71 H 1 1.935 0.003 . 1 . . 595 . A 14 DT H71 . 30803 1 116 . 1 . 1 11 11 DT H72 H 1 1.935 0.003 . 1 . . 595 . A 14 DT H72 . 30803 1 117 . 1 . 1 11 11 DT H73 H 1 1.935 0.003 . 1 . . 595 . A 14 DT H73 . 30803 1 118 . 1 . 1 11 11 DT C6 C 13 140.327 . . 1 . . 734 . A 14 DT C6 . 30803 1 119 . 1 . 1 12 12 DA H1' H 1 6.699 0.002 . 1 . . 543 . A 15 DA H1' . 30803 1 120 . 1 . 1 12 12 DA H2 H 1 8.378 0.001 . 1 . . 579 . A 15 DA H2 . 30803 1 121 . 1 . 1 12 12 DA H2' H 1 3.095 0.002 . 1 . . 544 . A 15 DA H2' . 30803 1 122 . 1 . 1 12 12 DA H2'' H 1 2.979 0.003 . 1 . . 545 . A 15 DA H2'' . 30803 1 123 . 1 . 1 12 12 DA H3' H 1 5.201 0.005 . 1 . . 654 . A 15 DA H3' . 30803 1 124 . 1 . 1 12 12 DA H4' H 1 4.613 0.003 . 1 . . 700 . A 15 DA H4' . 30803 1 125 . 1 . 1 12 12 DA H5' H 1 4.309 0.0 . 2 . . 701 . A 15 DA H5' . 30803 1 126 . 1 . 1 12 12 DA H5'' H 1 4.216 0.003 . 2 . . 702 . A 15 DA H5'' . 30803 1 127 . 1 . 1 12 12 DA H8 H 1 8.537 0.002 . 1 . . 542 . A 15 DA H8 . 30803 1 128 . 1 . 1 12 12 DA C2 C 13 156.027 . . 1 . . 647 . A 15 DA C2 . 30803 1 129 . 1 . 1 12 12 DA C8 C 13 143.726 . . 1 . . 546 . A 15 DA C8 . 30803 1 130 . 1 . 1 13 13 DG H1 H 1 11.893 0.003 . 1 . . 636 . A 16 DG H1 . 30803 1 131 . 1 . 1 13 13 DG H1' H 1 6.202 0.003 . 1 . . 588 . A 16 DG H1' . 30803 1 132 . 1 . 1 13 13 DG H2' H 1 2.677 0.001 . 1 . . 589 . A 16 DG H2' . 30803 1 133 . 1 . 1 13 13 DG H2'' H 1 3.026 0.001 . 1 . . 590 . A 16 DG H2'' . 30803 1 134 . 1 . 1 13 13 DG H3' H 1 5.055 0.004 . 1 . . 655 . A 16 DG H3' . 30803 1 135 . 1 . 1 13 13 DG H4' H 1 4.491 0.004 . 1 . . 699 . A 16 DG H4' . 30803 1 136 . 1 . 1 13 13 DG H5' H 1 4.286 0.003 . 2 . . 697 . A 16 DG H5' . 30803 1 137 . 1 . 1 13 13 DG H5'' H 1 4.179 0.004 . 2 . . 698 . A 16 DG H5'' . 30803 1 138 . 1 . 1 13 13 DG H8 H 1 8.152 0.001 . 1 . . 564 . A 16 DG H8 . 30803 1 139 . 1 . 1 13 13 DG C8 C 13 138.824 . . 1 . . 591 . A 16 DG C8 . 30803 1 140 . 1 . 1 14 14 DG H1 H 1 11.295 0.003 . 1 . . 635 . A 17 DG H1 . 30803 1 141 . 1 . 1 14 14 DG H1' H 1 6.227 0.001 . 1 . . 585 . A 17 DG H1' . 30803 1 142 . 1 . 1 14 14 DG H2' H 1 2.699 0.002 . 1 . . 586 . A 17 DG H2' . 30803 1 143 . 1 . 1 14 14 DG H2'' H 1 2.987 0.003 . 1 . . 587 . A 17 DG H2'' . 30803 1 144 . 1 . 1 14 14 DG H3' H 1 5.038 0.004 . 1 . . 666 . A 17 DG H3' . 30803 1 145 . 1 . 1 14 14 DG H4' H 1 4.563 0.001 . 1 . . 717 . A 17 DG H4' . 30803 1 146 . 1 . 1 14 14 DG H5' H 1 4.241 . . 2 . . 2095 . A 17 DG H5' . 30803 1 147 . 1 . 1 14 14 DG H5'' H 1 4.295 . . 2 . . 2096 . A 17 DG H5'' . 30803 1 148 . 1 . 1 14 14 DG H8 H 1 7.814 0.002 . 1 . . 580 . A 17 DG H8 . 30803 1 149 . 1 . 1 14 14 DG H21 H 1 9.214 . . 1 . . 766 . A 17 DG H21 . 30803 1 150 . 1 . 1 14 14 DG H22 H 1 6.701 . . 1 . . 765 . A 17 DG H22 . 30803 1 151 . 1 . 1 14 14 DG C8 C 13 138.047 . . 1 . . 593 . A 17 DG C8 . 30803 1 152 . 1 . 1 15 15 DG H1 H 1 11.212 0.001 . 1 . . 637 . A 18 DG H1 . 30803 1 153 . 1 . 1 15 15 DG H1' H 1 6.491 0.005 . 1 . . 582 . A 18 DG H1' . 30803 1 154 . 1 . 1 15 15 DG H2' H 1 2.712 0.002 . 1 . . 583 . A 18 DG H2' . 30803 1 155 . 1 . 1 15 15 DG H2'' H 1 2.636 0.001 . 1 . . 584 . A 18 DG H2'' . 30803 1 156 . 1 . 1 15 15 DG H3' H 1 5.155 0.001 . 1 . . 667 . A 18 DG H3' . 30803 1 157 . 1 . 1 15 15 DG H4' H 1 4.640 0.004 . 1 . . 718 . A 18 DG H4' . 30803 1 158 . 1 . 1 15 15 DG H5' H 1 4.420 0.001 . 2 . . 727 . A 18 DG H5' . 30803 1 159 . 1 . 1 15 15 DG H5'' H 1 4.309 0.0 . 2 . . 728 . A 18 DG H5'' . 30803 1 160 . 1 . 1 15 15 DG H8 H 1 7.831 0.001 . 1 . . 581 . A 18 DG H8 . 30803 1 161 . 1 . 1 15 15 DG C8 C 13 138.472 . . 1 . . 592 . A 18 DG C8 . 30803 1 162 . 1 . 1 16 16 DT H1' H 1 6.541 0.003 . 1 . . 739 . A 19 DT H1' . 30803 1 163 . 1 . 1 16 16 DT H2' H 1 2.486 . . 1 . . 747 . A 19 DT H2' . 30803 1 164 . 1 . 1 16 16 DT H2'' H 1 2.687 0.001 . 1 . . 748 . A 19 DT H2'' . 30803 1 165 . 1 . 1 16 16 DT H3' H 1 5.132 0.003 . 1 . . 742 . A 19 DT H3' . 30803 1 166 . 1 . 1 16 16 DT H4' H 1 4.628 0.001 . 1 . . 741 . A 19 DT H4' . 30803 1 167 . 1 . 1 16 16 DT H5' H 1 4.313 0.005 . 2 . . 731 . A 19 DT H5' . 30803 1 168 . 1 . 1 16 16 DT H5'' H 1 4.369 0.003 . 2 . . 732 . A 19 DT H5'' . 30803 1 169 . 1 . 1 16 16 DT H6 H 1 7.874 0.001 . 1 . . 733 . A 19 DT H6 . 30803 1 170 . 1 . 1 16 16 DT H71 H 1 1.999 0.005 . 1 . . 745 . A 19 DT H71 . 30803 1 171 . 1 . 1 16 16 DT H72 H 1 1.999 0.005 . 1 . . 745 . A 19 DT H72 . 30803 1 172 . 1 . 1 16 16 DT H73 H 1 1.999 0.005 . 1 . . 745 . A 19 DT H73 . 30803 1 173 . 1 . 1 16 16 DT C6 C 13 140.247 . . 1 . . 735 . A 19 DT C6 . 30803 1 174 . 1 . 1 17 17 DG H1 H 1 11.267 0.004 . 1 . . 646 . A 20 DG H1 . 30803 1 175 . 1 . 1 17 17 DG H1' H 1 5.972 0.004 . 1 . . 630 . A 20 DG H1' . 30803 1 176 . 1 . 1 17 17 DG H2' H 1 2.347 0.003 . 1 . . 631 . A 20 DG H2' . 30803 1 177 . 1 . 1 17 17 DG H2'' H 1 2.764 0.002 . 1 . . 632 . A 20 DG H2'' . 30803 1 178 . 1 . 1 17 17 DG H3' H 1 5.095 0.003 . 1 . . 669 . A 20 DG H3' . 30803 1 179 . 1 . 1 17 17 DG H4' H 1 4.464 0.001 . 1 . . 756 . A 20 DG H4' . 30803 1 180 . 1 . 1 17 17 DG H5' H 1 4.282 . . 2 . . 757 . A 20 DG H5' . 30803 1 181 . 1 . 1 17 17 DG H5'' H 1 4.342 . . 2 . . 758 . A 20 DG H5'' . 30803 1 182 . 1 . 1 17 17 DG H8 H 1 7.915 0.001 . 1 . . 633 . A 20 DG H8 . 30803 1 183 . 1 . 1 17 17 DG C8 C 13 138.102 . . 1 . . 634 . A 20 DG C8 . 30803 1 184 . 1 . 1 18 18 DG H1 H 1 11.459 0.002 . 1 . . 645 . A 21 DG H1 . 30803 1 185 . 1 . 1 18 18 DG H1' H 1 5.930 0.002 . 1 . . 610 . A 21 DG H1' . 30803 1 186 . 1 . 1 18 18 DG H2' H 1 2.613 0.002 . 1 . . 611 . A 21 DG H2' . 30803 1 187 . 1 . 1 18 18 DG H2'' H 1 2.621 0.002 . 1 . . 612 . A 21 DG H2'' . 30803 1 188 . 1 . 1 18 18 DG H3' H 1 5.048 0.002 . 1 . . 668 . A 21 DG H3' . 30803 1 189 . 1 . 1 18 18 DG H4' H 1 4.495 0.0 . 1 . . 716 . A 21 DG H4' . 30803 1 190 . 1 . 1 18 18 DG H5' H 1 4.243 . . 2 . . 759 . A 21 DG H5' . 30803 1 191 . 1 . 1 18 18 DG H5'' H 1 4.170 . . 2 . . 760 . A 21 DG H5'' . 30803 1 192 . 1 . 1 18 18 DG H8 H 1 7.886 0.001 . 1 . . 628 . A 21 DG H8 . 30803 1 193 . 1 . 1 18 18 DG C8 C 13 138.659 . . 1 . . 629 . A 21 DG C8 . 30803 1 194 . 1 . 1 19 19 DG H1 H 1 10.997 0.004 . 1 . . 644 . A 22 DG H1 . 30803 1 195 . 1 . 1 19 19 DG H1' H 1 5.979 0.002 . 1 . . 605 . A 22 DG H1' . 30803 1 196 . 1 . 1 19 19 DG H2' H 1 2.094 0.002 . 1 . . 607 . A 22 DG H2' . 30803 1 197 . 1 . 1 19 19 DG H2'' H 1 2.562 0.004 . 1 . . 606 . A 22 DG H2'' . 30803 1 198 . 1 . 1 19 19 DG H3' H 1 4.904 0.006 . 1 . . 670 . A 22 DG H3' . 30803 1 199 . 1 . 1 19 19 DG H4' H 1 4.475 . . 1 . . 689 . A 22 DG H4' . 30803 1 200 . 1 . 1 19 19 DG H5' H 1 4.225 0.005 . 2 . . 690 . A 22 DG H5' . 30803 1 201 . 1 . 1 19 19 DG H5'' H 1 4.128 0.003 . 2 . . 691 . A 22 DG H5'' . 30803 1 202 . 1 . 1 19 19 DG H8 H 1 7.289 0.001 . 1 . . 608 . A 22 DG H8 . 30803 1 203 . 1 . 1 19 19 DG C8 C 13 136.769 . . 1 . . 609 . A 22 DG C8 . 30803 1 204 . 1 . 1 20 20 DG H1' H 1 5.137 0.005 . 1 . . 603 . A 23 DG H1' . 30803 1 205 . 1 . 1 20 20 DG H2' H 1 2.438 0.003 . 1 . . 676 . A 23 DG H2' . 30803 1 206 . 1 . 1 20 20 DG H2'' H 1 2.364 0.003 . 1 . . 677 . A 23 DG H2'' . 30803 1 207 . 1 . 1 20 20 DG H3' H 1 4.840 0.002 . 1 . . 671 . A 23 DG H3' . 30803 1 208 . 1 . 1 20 20 DG H4' H 1 4.381 . . 1 . . 715 . A 23 DG H4' . 30803 1 209 . 1 . 1 20 20 DG H5' H 1 4.114 0.004 . 2 . . 713 . A 23 DG H5' . 30803 1 210 . 1 . 1 20 20 DG H5'' H 1 4.175 0.004 . 2 . . 714 . A 23 DG H5'' . 30803 1 211 . 1 . 1 20 20 DG H8 H 1 7.801 0.001 . 1 . . 602 . A 23 DG H8 . 30803 1 212 . 1 . 1 20 20 DG C8 C 13 138.891 . . 1 . . 604 . A 23 DG C8 . 30803 1 213 . 1 . 1 21 21 DA H1' H 1 5.540 0.003 . 1 . . 601 . A 24 DA H1' . 30803 1 214 . 1 . 1 21 21 DA H2 H 1 7.664 0.002 . 1 . . 651 . A 24 DA H2 . 30803 1 215 . 1 . 1 21 21 DA H2' H 1 2.200 0.003 . 1 . . 709 . A 24 DA H2' . 30803 1 216 . 1 . 1 21 21 DA H2'' H 1 2.194 0.002 . 1 . . 710 . A 24 DA H2'' . 30803 1 217 . 1 . 1 21 21 DA H3' H 1 4.579 0.002 . 1 . . 711 . A 24 DA H3' . 30803 1 218 . 1 . 1 21 21 DA H4' H 1 2.938 0.002 . 1 . . 712 . A 24 DA H4' . 30803 1 219 . 1 . 1 21 21 DA H5' H 1 3.580 0.001 . 2 . . 692 . A 24 DA H5' . 30803 1 220 . 1 . 1 21 21 DA H5'' H 1 3.646 0.003 . 2 . . 693 . A 24 DA H5'' . 30803 1 221 . 1 . 1 21 21 DA H8 H 1 7.943 0.001 . 1 . . 599 . A 24 DA H8 . 30803 1 222 . 1 . 1 21 21 DA C2 C 13 155.196 . . 1 . . 650 . A 24 DA C2 . 30803 1 223 . 1 . 1 21 21 DA C8 C 13 142.188 . . 1 . . 600 . A 24 DA C8 . 30803 1 224 . 1 . 1 22 22 DA H1' H 1 5.852 0.003 . 1 . . 673 . A 25 DA H1' . 30803 1 225 . 1 . 1 22 22 DA H2 H 1 7.661 0.002 . 1 . . 652 . A 25 DA H2 . 30803 1 226 . 1 . 1 22 22 DA H2' H 1 2.490 0.004 . 1 . . 675 . A 25 DA H2' . 30803 1 227 . 1 . 1 22 22 DA H2'' H 1 2.427 0.002 . 1 . . 674 . A 25 DA H2'' . 30803 1 228 . 1 . 1 22 22 DA H3' H 1 4.443 0.002 . 1 . . 708 . A 25 DA H3' . 30803 1 229 . 1 . 1 22 22 DA H4' H 1 4.096 0.001 . 1 . . 686 . A 25 DA H4' . 30803 1 230 . 1 . 1 22 22 DA H5' H 1 3.886 0.003 . 2 . . 687 . A 25 DA H5' . 30803 1 231 . 1 . 1 22 22 DA H5'' H 1 3.689 0.003 . 2 . . 688 . A 25 DA H5'' . 30803 1 232 . 1 . 1 22 22 DA H8 H 1 7.883 0.001 . 1 . . 672 . A 25 DA H8 . 30803 1 233 . 1 . 1 22 22 DA C2 C 13 154.939 . . 1 . . 653 . A 25 DA C2 . 30803 1 234 . 1 . 1 22 22 DA C8 C 13 141.046 . . 1 . . 738 . A 25 DA C8 . 30803 1 stop_ save_