data_30816 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30816 _Entry.Title ; Au1 Domain of VEGF Readthrough Element ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-11-24 _Entry.Accession_date 2020-11-24 _Entry.Last_release_date 2020-12-17 _Entry.Original_release_date 2020-12-17 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 V. D'Souza V. M. . . 30816 2 N. Wagner N. O. . . 30816 3 J. Edwards J. M. . . 30816 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID RNA . 30816 'Stop codon readthrough' . 30816 'VEGF mRNA' . 30816 stem-loop . 30816 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30816 spectral_peak_list 2 30816 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 180 30816 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-05-26 . original BMRB . 30816 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7KUB 'BMRB Entry Tracking System' 30816 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30816 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Stop codon readthrough in VEGF-A is regulated by complex signals ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 N. Wagner N. O. . . 30816 1 2 J. Edwards J. E. . . 30816 1 3 J. Abramovich J. . . . 30816 1 4 P. Gupta P. . . . 30816 1 5 H. Swaminathan H. . . . 30816 1 6 S. Rouskin S. . . . 30816 1 7 V. D'Souza V. M. . . 30816 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30816 _Assembly.ID 1 _Assembly.Name 'RNA (60-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 30816 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30816 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; CUGCUCUACCUUCACCAUGC CAAGUGGUCCCAGGCUGCAC CCAUGGCAGAAGGAGGGCAG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 60 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 19268.506 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 43 C . 30816 1 2 44 U . 30816 1 3 45 G . 30816 1 4 46 C . 30816 1 5 47 U . 30816 1 6 48 C . 30816 1 7 49 U . 30816 1 8 50 A . 30816 1 9 51 C . 30816 1 10 52 C . 30816 1 11 53 U . 30816 1 12 54 U . 30816 1 13 55 C . 30816 1 14 56 A . 30816 1 15 57 C . 30816 1 16 58 C . 30816 1 17 59 A . 30816 1 18 60 U . 30816 1 19 61 G . 30816 1 20 62 C . 30816 1 21 63 C . 30816 1 22 64 A . 30816 1 23 65 A . 30816 1 24 66 G . 30816 1 25 67 U . 30816 1 26 68 G . 30816 1 27 69 G . 30816 1 28 70 U . 30816 1 29 71 C . 30816 1 30 72 C . 30816 1 31 73 C . 30816 1 32 74 A . 30816 1 33 75 G . 30816 1 34 76 G . 30816 1 35 77 C . 30816 1 36 78 U . 30816 1 37 79 G . 30816 1 38 80 C . 30816 1 39 81 A . 30816 1 40 82 C . 30816 1 41 83 C . 30816 1 42 84 C . 30816 1 43 85 A . 30816 1 44 86 U . 30816 1 45 87 G . 30816 1 46 88 G . 30816 1 47 89 C . 30816 1 48 90 A . 30816 1 49 91 G . 30816 1 50 92 A . 30816 1 51 93 A . 30816 1 52 94 G . 30816 1 53 95 G . 30816 1 54 96 A . 30816 1 55 97 G . 30816 1 56 98 G . 30816 1 57 99 G . 30816 1 58 100 C . 30816 1 59 101 A . 30816 1 60 102 G . 30816 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . C 1 1 30816 1 . U 2 2 30816 1 . G 3 3 30816 1 . C 4 4 30816 1 . U 5 5 30816 1 . C 6 6 30816 1 . U 7 7 30816 1 . A 8 8 30816 1 . C 9 9 30816 1 . C 10 10 30816 1 . U 11 11 30816 1 . U 12 12 30816 1 . C 13 13 30816 1 . A 14 14 30816 1 . C 15 15 30816 1 . C 16 16 30816 1 . A 17 17 30816 1 . U 18 18 30816 1 . G 19 19 30816 1 . C 20 20 30816 1 . C 21 21 30816 1 . A 22 22 30816 1 . A 23 23 30816 1 . G 24 24 30816 1 . U 25 25 30816 1 . G 26 26 30816 1 . G 27 27 30816 1 . U 28 28 30816 1 . C 29 29 30816 1 . C 30 30 30816 1 . C 31 31 30816 1 . A 32 32 30816 1 . G 33 33 30816 1 . G 34 34 30816 1 . C 35 35 30816 1 . U 36 36 30816 1 . G 37 37 30816 1 . C 38 38 30816 1 . A 39 39 30816 1 . C 40 40 30816 1 . C 41 41 30816 1 . C 42 42 30816 1 . A 43 43 30816 1 . U 44 44 30816 1 . G 45 45 30816 1 . G 46 46 30816 1 . C 47 47 30816 1 . A 48 48 30816 1 . G 49 49 30816 1 . A 50 50 30816 1 . A 51 51 30816 1 . G 52 52 30816 1 . G 53 53 30816 1 . A 54 54 30816 1 . G 55 55 30816 1 . G 56 56 30816 1 . G 57 57 30816 1 . C 58 58 30816 1 . A 59 59 30816 1 . G 60 60 30816 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30816 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9913 organism . 'Bos taurus' cow . . Eukaryota Metazoa Bos taurus . . . . . . . . . . . . . 30816 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30816 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30816 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30816 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '100 uM RNA (60-MER), 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (60-MER)' . . . 1 $entity_1 . . 100 . . uM 0.1 . . . 30816 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 30816 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '100 uM RNA (60-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (60-MER)' . . . 1 $entity_1 . . 100 . . uM 0.1 . . . 30816 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 30816 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '100 uM RNA (60-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (60-MER)' . . . 1 $entity_1 . . 100 . . uM 0.1 . . . 30816 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 30816 _Sample.ID 4 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '100 uM RNA (60-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (60-MER)' . . . 1 $entity_1 . . 100 . . uM 0.1 . . . 30816 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 30816 _Sample.ID 5 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '100 uM RNA (60-MER), 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'RNA (60-MER)' . . . 1 $entity_1 . . 100 . . uM 0.1 . . . 30816 5 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30816 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 30816 1 pH 5.6 . pH 30816 1 pressure 1 . . 30816 1 temperature 280 . K 30816 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 30816 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 30816 2 pH 5.6 . pH 30816 2 pressure 1 . . 30816 2 temperature 311 . K 30816 2 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 30816 _Sample_condition_list.ID 3 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 30816 3 pH 8.0 . pH 30816 3 pressure 1 . . 30816 3 temperature 311 . K 30816 3 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30816 _Software.ID 1 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 30816 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 30816 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30816 _Software.ID 2 _Software.Type . _Software.Name NMRViewJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Johnson, Bruce' . . 30816 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 30816 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 30816 _Software.ID 3 _Software.Type . _Software.Name CYANA _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 30816 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 30816 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 30816 _Software.ID 4 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30816 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30816 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30816 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Ascend800 _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30816 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker Ascend800 . 800 . . . 30816 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30816 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30816 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30816 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 3 $sample_conditions_3 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30816 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30816 1 5 '2D 1H-1H NOESY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 3 $sample_conditions_3 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30816 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30816 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 30816 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30816 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 30816 1 2 '2D 1H-1H NOESY' . . . 30816 1 3 '2D 1H-1H NOESY' . . . 30816 1 4 '2D 1H-1H NOESY' . . . 30816 1 5 '2D 1H-1H NOESY' . . . 30816 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 C H1' H 1 5.6890 0.0000 . 1 . . . . A 43 C H1' . 30816 1 2 . 1 . 1 1 1 C H5 H 1 6.1282 0.0000 . 1 . . . . A 43 C H5 . 30816 1 3 . 1 . 1 1 1 C H6 H 1 8.1719 0.0000 . 1 . . . . A 43 C H6 . 30816 1 4 . 1 . 1 2 2 U H1' H 1 5.7693 0.0000 . 1 . . . . A 44 U H1' . 30816 1 5 . 1 . 1 2 2 U H5 H 1 5.6139 0.0000 . 1 . . . . A 44 U H5 . 30816 1 6 . 1 . 1 2 2 U H6 H 1 8.0942 0.0000 . 1 . . . . A 44 U H6 . 30816 1 7 . 1 . 1 3 3 G H1 H 1 12.6821 0.0000 . 1 . . . . A 45 G H1 . 30816 1 8 . 1 . 1 3 3 G H1' H 1 5.8938 0.0000 . 1 . . . . A 45 G H1' . 30816 1 9 . 1 . 1 3 3 G H8 H 1 7.8727 0.0000 . 1 . . . . A 45 G H8 . 30816 1 10 . 1 . 1 4 4 C H1' H 1 5.5841 0.0000 . 1 . . . . A 46 C H1' . 30816 1 11 . 1 . 1 4 4 C H5 H 1 5.2802 0.0000 . 1 . . . . A 46 C H5 . 30816 1 12 . 1 . 1 4 4 C H6 H 1 7.6580 0.0000 . 1 . . . . A 46 C H6 . 30816 1 13 . 1 . 1 5 5 U H1' H 1 5.7127 0.0000 . 1 . . . . A 47 U H1' . 30816 1 14 . 1 . 1 5 5 U H3 H 1 12.3065 0.0000 . 1 . . . . A 47 U H3 . 30816 1 15 . 1 . 1 5 5 U H5 H 1 5.6385 0.0000 . 1 . . . . A 47 U H5 . 30816 1 16 . 1 . 1 5 5 U H6 H 1 8.0431 0.0000 . 1 . . . . A 47 U H6 . 30816 1 17 . 1 . 1 6 6 C H1' H 1 5.6833 0.0000 . 1 . . . . A 48 C H1' . 30816 1 18 . 1 . 1 6 6 C H5 H 1 5.6718 0.0000 . 1 . . . . A 48 C H5 . 30816 1 19 . 1 . 1 6 6 C H6 H 1 7.9810 0.0000 . 1 . . . . A 48 C H6 . 30816 1 20 . 1 . 1 7 7 U H1' H 1 6.0306 0.0000 . 1 . . . . A 49 U H1' . 30816 1 21 . 1 . 1 7 7 U H3 H 1 13.9113 0.0000 . 1 . . . . A 49 U H3 . 30816 1 22 . 1 . 1 7 7 U H5 H 1 5.5575 0.0000 . 1 . . . . A 49 U H5 . 30816 1 23 . 1 . 1 7 7 U H6 H 1 7.8696 0.0000 . 1 . . . . A 49 U H6 . 30816 1 24 . 1 . 1 8 8 A H1' H 1 6.2295 0.0000 . 1 . . . . A 50 A H1' . 30816 1 25 . 1 . 1 8 8 A H2 H 1 7.3382 0.0000 . 1 . . . . A 50 A H2 . 30816 1 26 . 1 . 1 8 8 A H8 H 1 7.7555 0.0000 . 1 . . . . A 50 A H8 . 30816 1 27 . 1 . 1 9 9 C H1' H 1 5.8169 0.0000 . 1 . . . . A 51 C H1' . 30816 1 28 . 1 . 1 9 9 C H5 H 1 5.8010 0.0000 . 1 . . . . A 51 C H5 . 30816 1 29 . 1 . 1 9 9 C H6 H 1 7.6283 0.0000 . 1 . . . . A 51 C H6 . 30816 1 30 . 1 . 1 10 10 C H1' H 1 5.6148 0.0000 . 1 . . . . A 52 C H1' . 30816 1 31 . 1 . 1 10 10 C H5 H 1 5.5455 0.0000 . 1 . . . . A 52 C H5 . 30816 1 32 . 1 . 1 10 10 C H6 H 1 7.9376 0.0000 . 1 . . . . A 52 C H6 . 30816 1 33 . 1 . 1 11 11 U H1' H 1 5.6163 0.0000 . 1 . . . . A 53 U H1' . 30816 1 34 . 1 . 1 11 11 U H3 H 1 14.0545 0.0000 . 1 . . . . A 53 U H3 . 30816 1 35 . 1 . 1 11 11 U H5 H 1 5.4923 0.0000 . 1 . . . . A 53 U H5 . 30816 1 36 . 1 . 1 11 11 U H6 H 1 7.9517 0.0000 . 1 . . . . A 53 U H6 . 30816 1 37 . 1 . 1 12 12 U H1' H 1 5.7335 0.0000 . 1 . . . . A 54 U H1' . 30816 1 38 . 1 . 1 12 12 U H3 H 1 13.8441 0.0000 . 1 . . . . A 54 U H3 . 30816 1 39 . 1 . 1 12 12 U H5 H 1 5.7547 0.0000 . 1 . . . . A 54 U H5 . 30816 1 40 . 1 . 1 12 12 U H6 H 1 7.6157 0.0000 . 1 . . . . A 54 U H6 . 30816 1 41 . 1 . 1 13 13 C H1' H 1 5.6944 0.0000 . 1 . . . . A 55 C H1' . 30816 1 42 . 1 . 1 13 13 C H5 H 1 5.7261 0.0000 . 1 . . . . A 55 C H5 . 30816 1 43 . 1 . 1 13 13 C H6 H 1 7.7994 0.0000 . 1 . . . . A 55 C H6 . 30816 1 44 . 1 . 1 14 14 A H1' H 1 5.9399 0.0000 . 1 . . . . A 56 A H1' . 30816 1 45 . 1 . 1 14 14 A H8 H 1 8.2986 0.0000 . 1 . . . . A 56 A H8 . 30816 1 46 . 1 . 1 15 15 C H5 H 1 5.5216 0.0000 . 1 . . . . A 57 C H5 . 30816 1 47 . 1 . 1 15 15 C H6 H 1 7.7316 0.0000 . 1 . . . . A 57 C H6 . 30816 1 48 . 1 . 1 16 16 C H5'' H 1 4.108 0.0000 . 1 . . . . A 58 C H5'' . 30816 1 49 . 1 . 1 17 17 A H1' H 1 5.9077 0.0000 . 1 . . . . A 59 A H1' . 30816 1 50 . 1 . 1 17 17 A H2 H 1 7.3925 0.0000 . 1 . . . . A 59 A H2 . 30816 1 51 . 1 . 1 17 17 A H8 H 1 8.1674 0.0000 . 1 . . . . A 59 A H8 . 30816 1 52 . 1 . 1 18 18 U H1' H 1 5.6033 0.0000 . 1 . . . . A 60 U H1' . 30816 1 53 . 1 . 1 18 18 U H3 H 1 13.1825 0.0000 . 1 . . . . A 60 U H3 . 30816 1 54 . 1 . 1 18 18 U H5 H 1 5.0840 0.0000 . 1 . . . . A 60 U H5 . 30816 1 55 . 1 . 1 18 18 U H6 H 1 7.3897 0.0000 . 1 . . . . A 60 U H6 . 30816 1 56 . 1 . 1 19 19 G H1 H 1 12.9101 0.0000 . 1 . . . . A 61 G H1 . 30816 1 57 . 1 . 1 19 19 G H1' H 1 5.7373 0.0000 . 1 . . . . A 61 G H1' . 30816 1 58 . 1 . 1 19 19 G H8 H 1 7.7513 0.0000 . 1 . . . . A 61 G H8 . 30816 1 59 . 1 . 1 20 20 C H5 H 1 5.7002 0.0000 . 1 . . . . A 62 C H5 . 30816 1 60 . 1 . 1 20 20 C H6 H 1 7.8627 0.0000 . 1 . . . . A 62 C H6 . 30816 1 61 . 1 . 1 21 21 C H1' H 1 5.9397 0.0000 . 1 . . . . A 63 C H1' . 30816 1 62 . 1 . 1 21 21 C H6 H 1 8.2222 0.0000 . 1 . . . . A 63 C H6 . 30816 1 63 . 1 . 1 22 22 A H5'' H 1 4.435 0.0000 . 1 . . . . A 64 A H5'' . 30816 1 64 . 1 . 1 23 23 A H1' H 1 6.0547 0.0000 . 1 . . . . A 65 A H1' . 30816 1 65 . 1 . 1 24 24 G H1 H 1 13.4878 0.0000 . 1 . . . . A 66 G H1 . 30816 1 66 . 1 . 1 24 24 G H1' H 1 5.7759 0.0000 . 1 . . . . A 66 G H1' . 30816 1 67 . 1 . 1 24 24 G H8 H 1 7.6557 0.0000 . 1 . . . . A 66 G H8 . 30816 1 68 . 1 . 1 25 25 U H1' H 1 5.9117 0.0000 . 1 . . . . A 67 U H1' . 30816 1 69 . 1 . 1 25 25 U H3 H 1 11.8254 0.0000 . 1 . . . . A 67 U H3 . 30816 1 70 . 1 . 1 25 25 U H5 H 1 5.8464 0.0000 . 1 . . . . A 67 U H5 . 30816 1 71 . 1 . 1 25 25 U H6 H 1 7.8698 0.0000 . 1 . . . . A 67 U H6 . 30816 1 72 . 1 . 1 26 26 G H1 H 1 11.6953 0.0000 . 1 . . . . A 68 G H1 . 30816 1 73 . 1 . 1 26 26 G H1' H 1 5.8604 0.0000 . 1 . . . . A 68 G H1' . 30816 1 74 . 1 . 1 26 26 G H8 H 1 6.9373 0.0000 . 1 . . . . A 68 G H8 . 30816 1 75 . 1 . 1 27 27 G H1 H 1 13.6051 0.0000 . 1 . . . . A 69 G H1 . 30816 1 76 . 1 . 1 27 27 G H1' H 1 5.8733 0.0000 . 1 . . . . A 69 G H1' . 30816 1 77 . 1 . 1 27 27 G H8 H 1 7.4372 0.0000 . 1 . . . . A 69 G H8 . 30816 1 78 . 1 . 1 28 28 U H1' H 1 5.8543 0.0000 . 1 . . . . A 70 U H1' . 30816 1 79 . 1 . 1 28 28 U H3 H 1 12.1860 0.0000 . 1 . . . . A 70 U H3 . 30816 1 80 . 1 . 1 28 28 U H5 H 1 5.8916 0.0000 . 1 . . . . A 70 U H5 . 30816 1 81 . 1 . 1 28 28 U H6 H 1 7.9179 0.0000 . 1 . . . . A 70 U H6 . 30816 1 82 . 1 . 1 29 29 C H1' H 1 5.6145 0.0000 . 1 . . . . A 71 C H1' . 30816 1 83 . 1 . 1 29 29 C H5 H 1 5.4824 0.0000 . 1 . . . . A 71 C H5 . 30816 1 84 . 1 . 1 29 29 C H6 H 1 7.7053 0.0000 . 1 . . . . A 71 C H6 . 30816 1 85 . 1 . 1 30 30 C H1' H 1 5.5278 0.0000 . 1 . . . . A 72 C H1' . 30816 1 86 . 1 . 1 30 30 C H5 H 1 5.5455 0.0000 . 1 . . . . A 72 C H5 . 30816 1 87 . 1 . 1 30 30 C H6 H 1 7.7853 0.0000 . 1 . . . . A 72 C H6 . 30816 1 88 . 1 . 1 31 31 C H1' H 1 6.0904 0.0000 . 1 . . . . A 73 C H1' . 30816 1 89 . 1 . 1 31 31 C H5 H 1 6.0601 0.0000 . 1 . . . . A 73 C H5 . 30816 1 90 . 1 . 1 31 31 C H6 H 1 7.9520 0.0000 . 1 . . . . A 73 C H6 . 30816 1 91 . 1 . 1 32 32 A H1' H 1 6.1018 0.0000 . 1 . . . . A 74 A H1' . 30816 1 92 . 1 . 1 32 32 A H8 H 1 7.8182 0.0000 . 1 . . . . A 74 A H8 . 30816 1 93 . 1 . 1 33 33 G H1 H 1 12.7283 0.0000 . 1 . . . . A 75 G H1 . 30816 1 94 . 1 . 1 33 33 G H8 H 1 5.5538 0.0000 . 1 . . . . A 75 G H8 . 30816 1 95 . 1 . 1 34 34 G H1 H 1 10.6896 0.0000 . 1 . . . . A 76 G H1 . 30816 1 96 . 1 . 1 34 34 G H1' H 1 5.8388 0.0000 . 1 . . . . A 76 G H1' . 30816 1 97 . 1 . 1 34 34 G H8 H 1 7.1378 0.0000 . 1 . . . . A 76 G H8 . 30816 1 98 . 1 . 1 35 35 C H1' H 1 5.4055 0.0000 . 1 . . . . A 77 C H1' . 30816 1 99 . 1 . 1 35 35 C H5 H 1 5.3831 0.0000 . 1 . . . . A 77 C H5 . 30816 1 100 . 1 . 1 35 35 C H6 H 1 7.6624 0.0000 . 1 . . . . A 77 C H6 . 30816 1 101 . 1 . 1 35 35 C H41 H 1 8.5873 0.0000 . 2 . . . . A 77 C H41 . 30816 1 102 . 1 . 1 35 35 C H42 H 1 7.0823 0.0000 . 2 . . . . A 77 C H42 . 30816 1 103 . 1 . 1 36 36 U H1' H 1 5.8417 0.0000 . 1 . . . . A 78 U H1' . 30816 1 104 . 1 . 1 36 36 U H3 H 1 12.4129 0.0000 . 1 . . . . A 78 U H3 . 30816 1 105 . 1 . 1 36 36 U H5 H 1 5.8751 0.0000 . 1 . . . . A 78 U H5 . 30816 1 106 . 1 . 1 36 36 U H6 H 1 7.8399 0.0000 . 1 . . . . A 78 U H6 . 30816 1 107 . 1 . 1 37 37 G H1 H 1 11.0192 0.0000 . 1 . . . . A 79 G H1 . 30816 1 108 . 1 . 1 37 37 G H1' H 1 5.8756 0.0000 . 1 . . . . A 79 G H1' . 30816 1 109 . 1 . 1 37 37 G H8 H 1 7.2842 0.0000 . 1 . . . . A 79 G H8 . 30816 1 110 . 1 . 1 38 38 C H1' H 1 5.5736 0.0000 . 1 . . . . A 80 C H1' . 30816 1 111 . 1 . 1 38 38 C H5 H 1 5.2892 0.0000 . 1 . . . . A 80 C H5 . 30816 1 112 . 1 . 1 38 38 C H6 H 1 7.5595 0.0000 . 1 . . . . A 80 C H6 . 30816 1 113 . 1 . 1 39 39 A H1' H 1 6.0134 0.0000 . 1 . . . . A 81 A H1' . 30816 1 114 . 1 . 1 39 39 A H8 H 1 7.8901 0.0000 . 1 . . . . A 81 A H8 . 30816 1 115 . 1 . 1 40 40 C H1' H 1 5.6662 0.0000 . 1 . . . . A 82 C H1' . 30816 1 116 . 1 . 1 40 40 C H6 H 1 7.9001 0.0000 . 1 . . . . A 82 C H6 . 30816 1 117 . 1 . 1 41 41 C H1' H 1 5.7234 0.0000 . 1 . . . . A 83 C H1' . 30816 1 118 . 1 . 1 41 41 C H5 H 1 5.9938 0.0000 . 1 . . . . A 83 C H5 . 30816 1 119 . 1 . 1 41 41 C H6 H 1 8.0655 0.0000 . 1 . . . . A 83 C H6 . 30816 1 120 . 1 . 1 42 42 C H1' H 1 5.7456 0.0000 . 1 . . . . A 84 C H1' . 30816 1 121 . 1 . 1 42 42 C H5 H 1 5.8129 0.0000 . 1 . . . . A 84 C H5 . 30816 1 122 . 1 . 1 42 42 C H6 H 1 8.0696 0.0000 . 1 . . . . A 84 C H6 . 30816 1 123 . 1 . 1 43 43 A H1' H 1 5.9221 0.0000 . 1 . . . . A 85 A H1' . 30816 1 124 . 1 . 1 43 43 A H2 H 1 7.3810 0.0000 . 1 . . . . A 85 A H2 . 30816 1 125 . 1 . 1 43 43 A H8 H 1 8.1812 0.0000 . 1 . . . . A 85 A H8 . 30816 1 126 . 1 . 1 44 44 U H1' H 1 5.5342 0.0000 . 1 . . . . A 86 U H1' . 30816 1 127 . 1 . 1 44 44 U H3 H 1 13.6076 0.0000 . 1 . . . . A 86 U H3 . 30816 1 128 . 1 . 1 44 44 U H5 H 1 5.1146 0.0000 . 1 . . . . A 86 U H5 . 30816 1 129 . 1 . 1 44 44 U H6 H 1 7.6137 0.0000 . 1 . . . . A 86 U H6 . 30816 1 130 . 1 . 1 45 45 G H1 H 1 12.2916 0.0000 . 1 . . . . A 87 G H1 . 30816 1 131 . 1 . 1 45 45 G H1' H 1 5.8250 0.0000 . 1 . . . . A 87 G H1' . 30816 1 132 . 1 . 1 45 45 G H8 H 1 7.6458 0.0000 . 1 . . . . A 87 G H8 . 30816 1 133 . 1 . 1 46 46 G H1 H 1 13.2187 0.0000 . 1 . . . . A 88 G H1 . 30816 1 134 . 1 . 1 46 46 G H1' H 1 5.6428 0.0000 . 1 . . . . A 88 G H1' . 30816 1 135 . 1 . 1 46 46 G H8 H 1 7.1426 0.0000 . 1 . . . . A 88 G H8 . 30816 1 136 . 1 . 1 47 47 C H1' H 1 5.8978 0.0000 . 1 . . . . A 89 C H1' . 30816 1 137 . 1 . 1 47 47 C H2' H 1 4.2575 0.0000 . 1 . . . . A 89 C H2' . 30816 1 138 . 1 . 1 47 47 C H3' H 1 4.5392 0.0000 . 1 . . . . A 89 C H3' . 30816 1 139 . 1 . 1 47 47 C H5 H 1 5.8353 0.0000 . 1 . . . . A 89 C H5 . 30816 1 140 . 1 . 1 47 47 C H6 H 1 7.3444 0.0000 . 1 . . . . A 89 C H6 . 30816 1 141 . 1 . 1 48 48 A H1' H 1 6.1306 0.0000 . 1 . . . . A 90 A H1' . 30816 1 142 . 1 . 1 48 48 A H2 H 1 7.8605 0.0000 . 1 . . . . A 90 A H2 . 30816 1 143 . 1 . 1 48 48 A H2' H 1 4.3526 0.0000 . 1 . . . . A 90 A H2' . 30816 1 144 . 1 . 1 48 48 A H3' H 1 4.2489 0.0000 . 1 . . . . A 90 A H3' . 30816 1 145 . 1 . 1 48 48 A H8 H 1 8.3410 0.0000 . 1 . . . . A 90 A H8 . 30816 1 146 . 1 . 1 49 49 G H1 H 1 12.0236 0.0000 . 1 . . . . A 91 G H1 . 30816 1 147 . 1 . 1 49 49 G H2' H 1 4.8042 0.0000 . 1 . . . . A 91 G H2' . 30816 1 148 . 1 . 1 49 49 G H8 H 1 7.8644 0.0000 . 1 . . . . A 91 G H8 . 30816 1 149 . 1 . 1 50 50 A H1' H 1 6.0099 0.0000 . 1 . . . . A 92 A H1' . 30816 1 150 . 1 . 1 50 50 A H2 H 1 7.1891 0.0000 . 1 . . . . A 92 A H2 . 30816 1 151 . 1 . 1 50 50 A H8 H 1 7.8118 0.0000 . 1 . . . . A 92 A H8 . 30816 1 152 . 1 . 1 51 51 A H1' H 1 5.9789 0.0000 . 1 . . . . A 93 A H1' . 30816 1 153 . 1 . 1 51 51 A H2 H 1 7.5507 0.0000 . 1 . . . . A 93 A H2 . 30816 1 154 . 1 . 1 51 51 A H8 H 1 7.7153 0.0000 . 1 . . . . A 93 A H8 . 30816 1 155 . 1 . 1 52 52 G H1 H 1 12.9616 0.0000 . 1 . . . . A 94 G H1 . 30816 1 156 . 1 . 1 52 52 G H1' H 1 5.6127 0.0000 . 1 . . . . A 94 G H1' . 30816 1 157 . 1 . 1 52 52 G H8 H 1 7.0474 0.0000 . 1 . . . . A 94 G H8 . 30816 1 158 . 1 . 1 53 53 G H1 H 1 12.6690 0.0000 . 1 . . . . A 95 G H1 . 30816 1 159 . 1 . 1 53 53 G H1' H 1 5.7345 0.0000 . 1 . . . . A 95 G H1' . 30816 1 160 . 1 . 1 53 53 G H8 H 1 7.0214 0.0000 . 1 . . . . A 95 G H8 . 30816 1 161 . 1 . 1 54 54 A H1' H 1 5.9805 0.0000 . 1 . . . . A 96 A H1' . 30816 1 162 . 1 . 1 54 54 A H2 H 1 7.6466 0.0000 . 1 . . . . A 96 A H2 . 30816 1 163 . 1 . 1 54 54 A H8 H 1 7.9193 0.0000 . 1 . . . . A 96 A H8 . 30816 1 164 . 1 . 1 55 55 G H1 H 1 13.6935 0.0000 . 1 . . . . A 97 G H1 . 30816 1 165 . 1 . 1 55 55 G H1' H 1 5.7008 0.0000 . 1 . . . . A 97 G H1' . 30816 1 166 . 1 . 1 55 55 G H8 H 1 7.3913 0.0000 . 1 . . . . A 97 G H8 . 30816 1 167 . 1 . 1 56 56 G H1 H 1 11.0058 0.0000 . 1 . . . . A 98 G H1 . 30816 1 168 . 1 . 1 56 56 G H1' H 1 5.7910 0.0000 . 1 . . . . A 98 G H1' . 30816 1 169 . 1 . 1 56 56 G H8 H 1 7.1162 0.0000 . 1 . . . . A 98 G H8 . 30816 1 170 . 1 . 1 57 57 G H1 H 1 13.4185 0.0000 . 1 . . . . A 99 G H1 . 30816 1 171 . 1 . 1 57 57 G H1' H 1 5.8052 0.0000 . 1 . . . . A 99 G H1' . 30816 1 172 . 1 . 1 57 57 G H8 H 1 7.2990 0.0000 . 1 . . . . A 99 G H8 . 30816 1 173 . 1 . 1 58 58 C H1' H 1 5.5869 0.0000 . 1 . . . . A 100 C H1' . 30816 1 174 . 1 . 1 58 58 C H5 H 1 5.3201 0.0000 . 1 . . . . A 100 C H5 . 30816 1 175 . 1 . 1 58 58 C H6 H 1 7.6740 0.0000 . 1 . . . . A 100 C H6 . 30816 1 176 . 1 . 1 59 59 A H1' H 1 5.9963 0.0000 . 1 . . . . A 101 A H1' . 30816 1 177 . 1 . 1 59 59 A H2 H 1 7.3117 0.0000 . 1 . . . . A 101 A H2 . 30816 1 178 . 1 . 1 59 59 A H8 H 1 8.0205 0.0000 . 1 . . . . A 101 A H8 . 30816 1 179 . 1 . 1 60 60 G H1' H 1 5.8190 0.0000 . 1 . . . . A 102 G H1' . 30816 1 180 . 1 . 1 60 60 G H8 H 1 7.4422 0.0000 . 1 . . . . A 102 G H8 . 30816 1 stop_ save_ ######################### # Spectral peak lists # ######################### save_spectral_peak_list_1 _Spectral_peak_list.Sf_category spectral_peak_list _Spectral_peak_list.Sf_framecode spectral_peak_list_1 _Spectral_peak_list.Entry_ID 30816 _Spectral_peak_list.ID 1 _Spectral_peak_list.Name . _Spectral_peak_list.Sample_ID 1 _Spectral_peak_list.Sample_label $sample_1 _Spectral_peak_list.Sample_condition_list_ID 1 _Spectral_peak_list.Sample_condition_list_label $sample_conditions_1 _Spectral_peak_list.Chem_shift_reference_ID 1 _Spectral_peak_list.Chem_shift_reference_label $chem_shift_reference_1 _Spectral_peak_list.Experiment_ID 1 _Spectral_peak_list.Experiment_name '2D 1H-1H NOESY' _Spectral_peak_list.Experiment_class . _Spectral_peak_list.Experiment_type . _Spectral_peak_list.Number_of_spectral_dimensions 2 _Spectral_peak_list.Chemical_shift_list . _Spectral_peak_list.Assigned_chem_shift_list_ID 1 _Spectral_peak_list.Assigned_chem_shift_list_label $assigned_chemical_shifts_1 _Spectral_peak_list.Details . _Spectral_peak_list.Text_data_format text _Spectral_peak_list.Text_data ; label dataset sw sf 1Hx 1Hy 200224_20_50superres.nv 18028.8457031 18028.8457031 800.239013672 800.239013672 1Hx.L 1Hx.P 1Hx.W 1Hx.B 1Hx.E 1Hx.J 1Hx.U 1Hy.L 1Hy.P 1Hy.W 1Hy.B 1Hy.E 1Hy.J 1Hy.U vol int stat comment flag0 flag8 flag9 0 {77.h41} 8.18732 0.01634 0.00227 ++ {0.0} {} {69.h1} 13.20585 0.10790 0.01669 ++ {0.0} {} 0.0 4.5027 0 {} 0 0 0 1 {77.h42} 6.68227 0.00610 0.01394 ++ {0.0} {} {69.h1} 13.23607 0.16052 0.16446 ++ {0.0} {} 0.0 3.5325 0 {} 0 0 0 2 {93.h2} 7.16094 0.02882 0.03193 ++ {0.0} {} {53.h3} 13.63170 0.07720 0.18617 ++ {0.0} {} 0.0 7.7094 0 {} 0 0 0 3 {68.h1} 11.29475 0.06042 0.05564 ++ {0.0} {} {78.h3} 12.01293 0.22666 0.21583 ++ {0.0} {} 0.0 2.6236 0 {} 0 0 0 4 {88.h1} 12.81836 0.06042 0.05564 ++ {0.0} {} {61.h1} 12.49636 0.22666 0.21583 ++ {0.0} {} 0.0 2.6236 0 {} 0 0 0 5 {87.h1} 12.53145 0.06042 0.05564 ++ {0.0} {} {88.h1} 12.81162 0.22666 0.21583 ++ {0.0} {} 0.0 2.6236 0 {} 0 0 0 6 {69.h1} 13.20788 0.05439 0.04345 ++ {0.0} {} {68.h1} 11.28287 0.14452 0.26790 ++ {0.0} {} 0.0 2.2472 0 {} 0 0 0 7 {69.h1} 13.19972 0.03969 0.02791 ++ {0.0} {} {70.h3} 11.78604 0.15061 0.24105 ++ {0.0} {} 0.0 2.0527 0 {} 0 0 0 8 {69.h1} 13.20308 0.03621 0.01474 ++ {0.0} {} {78.h1} 12.03496 0.12003 0.09241 ++ {0.0} {} 0.0 1.0640 0 {} 0 0 0 9 {76.h1} 10.27627 0.03812 0.05445 ++ {0.0} {} {76.h1} 10.31982 0.29663 0.34032 ++ {0.0} {} 0.0 2.0527 0 {} 0 0 0 10 {87.h1} 11.75440 0.01413 0.01380 ++ {0.0} {} {76.h1} 10.28808 0.12988 0.04769 ++ {0.0} {} 0.0 1.0416 0 {} 0 0 0 11 {79.h1} 10.72975 0.04894 0.12761 ++ {0.0} {} {79.h1} 10.73531 0.19700 0.28142 ++ {0.0} {} 0.0 10.8010 0 {} 0 0 0 12 {67.h3} 11.42544 0.01852 0.03620 ++ {0.0} {} {79.h1} 10.75907 0.30894 0.27244 ++ {0.0} {} 0.0 1.5994 0 {} 0 0 0 13 {76.h1} 10.27424 0.03538 0.01322 ++ {0.0} {} {75.h1} 12.34185 0.08796 0.09618 ++ {0.0} {} 0.0 1.0214 0 {} 0 0 0 14 {75.h1} 12.32107 0.07475 0.24272 ++ {0.0} {} {75.h1} 12.32212 0.19493 0.27847 ++ {0.0} {} 0.0 26.7146 0 {} 0 0 0 15 {68.h1} 11.28765 0.03812 0.05445 ++ {0.0} {} {68.h1} 11.31608 0.29663 0.34032 ++ {0.0} {} 0.0 2.0527 0 {} 0 0 0 16 {61.h1} 12.53302 0.06480 0.12342 ++ {0.0} {} {61.h1} 12.50100 0.19766 0.28236 ++ {0.0} {} 0.0 38.2434 0 {} 0 0 0 17 {47.h3} 11.90615 0.07200 0.10286 ++ {0.0} {} {97.h1} 13.27453 0.20268 0.28954 ++ {0.0} {} 0.0 30.4981 0 {} 0 0 0 18 {94.h1} 12.57238 0.08625 0.05784 ++ {0.0} {} {95.h1} 12.26904 0.13560 0.11357 ++ {0.0} {} 0.0 1.1464 0 {} 0 0 0 19 {66.h1} 13.08777 0.07382 0.05909 ++ {0.0} {} {79.h1} 10.25267 0.15521 0.11776 ++ {0.0} {} 0.0 1.1639 0 {} 0 0 0 20 {53.h3} 13.66812 0.12216 0.12888 ++ {0.0} {} {94.h1} 12.55086 0.08695 0.20160 ++ {0.0} {} 0.0 3.7632 0 {} 0 0 0 21 {54.h3} 13.42715 0.12216 0.12888 ++ {0.0} {} {91.h1} 11.62363 0.08695 0.20160 ++ {0.0} {} 0.0 3.7632 0 {} 0 0 0 22 {53.h3} 13.66374 0.12216 0.12888 ++ {0.0} {} {54.h3} 13.45615 0.08695 0.20160 ++ {0.0} {} 0.0 3.7632 0 {} 0 0 0 23 {47.h3} 11.91043 0.04265 0.07435 ++ {0.0} {} {98.h1} 10.60584 0.09646 0.19222 ++ {0.0} {} 0.0 6.2408 0 {} 0 0 0 24 {99.h1} 13.02191 0.05506 0.07865 ++ {0.0} {} {47.h3} 11.92529 0.19616 0.13440 ++ {0.0} {} 0.0 2.1647 0 {} 0 0 0 25 {49.h3} 13.51127 0.03812 0.05445 ++ {0.0} {} {97.h1} 13.31251 0.24622 0.35174 ++ {0.0} {} 0.0 4.5001 0 {} 0 0 0 26 {99.h1} 13.01518 0.02683 0.04604 ++ {0.0} {} {45.h1} 12.28209 0.09823 0.17860 ++ {0.0} {} 0.0 2.1511 0 {} 0 0 0 27 {86.h3} 13.18895 0.07806 0.08932 ++ {0.0} {} {60.h3} 12.77873 0.16258 0.19781 ++ {0.0} {} 0.0 3.5310 0 {} 0 0 0 28 {87.h1} 11.75319 0.02965 0.04235 ++ {0.0} {} {86.h3} 13.22844 0.14047 0.14106 ++ {0.0} {} 0.0 2.8488 0 {} 0 0 0 29 {88.h1} 12.83235 0.03989 0.02864 ++ {0.0} {} {87.h1} 11.81561 0.16235 0.11784 ++ {0.0} {} 0.0 2.1217 0 {} 0 0 0 30 {92.h2} 6.78083 0.04659 0.06655 ++ {0.0} {} {54.h3} 13.44912 0.20500 0.29286 ++ {0.0} {} 0.0 12.2078 0 {} 0 0 0 31 {85.h2} 7.06921 0.03062 0.11496 ++ {0.0} {} {60.h3} 12.78628 0.13674 0.22027 ++ {0.0} {} 0.0 20.3126 0 {} 0 0 0 32 {59.h2} 7.00465 0.03863 0.10286 ++ {0.0} {} {86.h3} 13.20538 0.09492 0.25197 ++ {0.0} {} 0.0 25.0231 0 {} 0 0 0 33 {47.h3} 11.90017 0.08044 0.07212 ++ {0.0} {} {47.h3} 11.89040 0.13177 0.11328 ++ {0.0} {} 0.0 15.1040 0 {} 0 0 0 34 {87.h1} 11.75077 0.08801 0.14224 ++ {0.0} {} {87.h1} 11.74427 0.13159 0.23358 ++ {0.0} {} 0.0 24.4280 0 {} 0 0 0 35 {69.h1} 13.19535 0.07476 0.13593 ++ {0.0} {} {69.h1} 13.18787 0.11197 0.21853 ++ {0.0} {} 0.0 25.8300 0 {} 0 0 0 36 {88.h1} 12.82227 0.11160 0.08907 ++ {0.0} {} {88.h1} 12.80868 0.15643 0.14091 ++ {0.0} {} 0.0 7.6829 0 {} 0 0 0 ; loop_ _Spectral_dim.ID _Spectral_dim.Axis_code _Spectral_dim.Spectrometer_frequency _Spectral_dim.Atom_type _Spectral_dim.Atom_isotope_number _Spectral_dim.Spectral_region _Spectral_dim.Magnetization_linkage_ID _Spectral_dim.Under_sampling_type _Spectral_dim.Sweep_width _Spectral_dim.Sweep_width_units _Spectral_dim.Value_first_point _Spectral_dim.Absolute_peak_positions _Spectral_dim.Acquisition _Spectral_dim.Center_frequency_offset _Spectral_dim.Encoding_code _Spectral_dim.Encoded_reduced_dimension_ID _Spectral_dim.Entry_ID _Spectral_dim.Spectral_peak_list_ID 1 . . H 1 H . . 18028.8457031 Hz . . . 4.706 . . 30816 1 2 . . H 1 H . . 18028.8457031 Hz . . . 4.706 . . 30816 1 stop_ save_ save_spectral_peak_list_2 _Spectral_peak_list.Sf_category spectral_peak_list _Spectral_peak_list.Sf_framecode spectral_peak_list_2 _Spectral_peak_list.Entry_ID 30816 _Spectral_peak_list.ID 2 _Spectral_peak_list.Name . _Spectral_peak_list.Sample_ID 5 _Spectral_peak_list.Sample_label $sample_5 _Spectral_peak_list.Sample_condition_list_ID 2 _Spectral_peak_list.Sample_condition_list_label $sample_conditions_2 _Spectral_peak_list.Chem_shift_reference_ID 1 _Spectral_peak_list.Chem_shift_reference_label $chem_shift_reference_1 _Spectral_peak_list.Experiment_ID 2 _Spectral_peak_list.Experiment_name '2D 1H-1H NOESY' _Spectral_peak_list.Experiment_class . _Spectral_peak_list.Experiment_type . _Spectral_peak_list.Number_of_spectral_dimensions 2 _Spectral_peak_list.Chemical_shift_list . _Spectral_peak_list.Assigned_chem_shift_list_ID 1 _Spectral_peak_list.Assigned_chem_shift_list_label $assigned_chemical_shifts_1 _Spectral_peak_list.Details . _Spectral_peak_list.Text_data_format text _Spectral_peak_list.Text_data ; label dataset sw sf 1Hx 1Hy 200113h3h4d20.nv 8012.820801 8012.820801 800.2390137 800.2390137 1Hx.L 1Hx.P 1Hx.W 1Hx.B 1Hx.E 1Hx.J 1Hx.U 1Hy.L 1Hy.P 1Hy.W 1Hy.B 1Hy.E 1Hy.J 1Hy.U vol int stat comment flag0 flag8 flag9 0 {100.h1'} 5.58686 0.01319 0.02187 ++ {0.0} {} {100.h6} 7.67111 0.0364 0.05528 ++ {0.0} {} 0 0.4775 0 {} 0 0 0 1 {100.h1'} 5.5869 0.01842 0.05596 ++ {0.0} {} {101.h8} 8.02279 0.0369 0.06912 ++ {0.0} {} 0 2.4915 0 {} 0 0 0 2 {100.h5} 5.32011 0.01868 0.05292 ++ {0.0} {} {100.h6} 7.67488 0.03272 0.06327 ++ {0.0} {} 0 2.2174 0 {} 0 0 0 3 {101.h1'} 5.99477 0.01275 0.01567 ++ {0.0} {} {102.h8} 7.44291 0.03719 0.04887 ++ {0.0} {} 0 0.5236 0 {} 0 0 0 4 {101.h1'} 5.99786 0.00982 0.00928 ++ {0.0} {} {101.h8} 8.01818 0.02559 0.02399 ++ {0.0} {} 0 0.3291 0 {} 0 0 0 5 {102.h1'} 5.81941 0.01262 0.01941 ++ {0.0} {} {101.h2} 7.31495 0.02693 0.0418 ++ {0.0} {} 0 0.781 0 {} 0 0 0 6 {102.h1'} 5.81869 0.01262 0.01941 ++ {0.0} {} {102.h8} 7.44149 0.02693 0.0418 ++ {0.0} {} 0 0.781 0 {} 0 0 0 7 {43.h1'} 5.68867 0.01321 0.03174 ++ {0.0} {} {43.h6} 8.17198 0.02496 0.04347 ++ {0.0} {} 0 1.038 0 {} 0 0 0 8 {43.h1'} 5.68932 0.01396 0.01555 ++ {0.0} {} {44.h6} 8.09491 0.02551 0.02996 ++ {0.0} {} 0 0.3389 0 {} 0 0 0 9 {43.h5} 6.12823 0.01634 0.04239 ++ {0.0} {} {43.h6} 8.17187 0.02371 0.05136 ++ {0.0} {} 0 6.2218 0 {} 0 0 0 10 {44.h1'} 5.76748 0.01125 0.0168 ++ {0.0} {} {44.h6} 8.09587 0.02033 0.03041 ++ {0.0} {} 0 0.5547 0 {} 0 0 0 11 {44.h1'} 5.77111 0.02271 0.05173 ++ {0.0} {} {45.h8} 7.87696 0.03085 0.06406 ++ {0.0} {} 0 1.6714 0 {} 0 0 0 12 {44.h5} 5.61393 0.01842 0.05871 ++ {0.0} {} {44.h6} 8.0918 0.0369 0.07009 ++ {0.0} {} 0 2.4915 0 {} 0 0 0 13 {45.h1'} 5.89346 0.01114 0.01476 ++ {0.0} {} {45.h8} 7.86842 0.02491 0.03178 ++ {0.0} {} 0 0.3864 0 {} 0 0 0 14 {45.h1'} 5.89381 0.01408 0.0156 ++ {0.0} {} {46.h6} 7.6587 0.0372 0.04217 ++ {0.0} {} 0 0.3216 0 {} 0 0 0 15 {45.h1'} 5.89402 0.01261 0.01356 ++ {0.0} {} {101.h2} 7.30854 0.03191 0.03511 ++ {0.0} {} 0 0.3886 0 {} 0 0 0 16 {46..h1'} 5.58881 0.01319 0.01885 ++ {0.0} {} {46.h6} 7.65775 0.0364 0.05141 ++ {0.0} {} 0 0.4775 0 {} 0 0 0 17 {46.h1'} 5.58411 0.0235 0.02762 ++ {0.0} {} {47.h6} 8.05224 0.05423 0.05727 ++ {0.0} {} 0 0.2627 0 {} 0 0 0 18 {46.h5} 5.28021 0.01868 0.05043 ++ {0.0} {} {46.h6} 7.65755 0.03272 0.06245 ++ {0.0} {} 0 2.2174 0 {} 0 0 0 19 {47.h1'} 5.71352 0.01249 0.01767 ++ {0.0} {} {47.h6} 8.07169 0.03195 0.04527 ++ {0.0} {} 0 0.5088 0 {} 0 0 0 20 {47.h1'} 5.71187 0.01214 0.01507 ++ {0.0} {} {48.h6} 7.98608 0.02235 0.02814 ++ {0.0} {} 0 0.3775 0 {} 0 0 0 21 {47.h5} 5.63851 0.02076 0.03496 ++ {0.0} {} {47.h6} 8.06489 0.03955 0.0692 ++ {0.0} {} 0 1.8085 0 {} 0 0 0 22 {48.h1'} 5.68226 0.01159 0.02137 ++ {0.0} {} {48.h6} 7.97734 0.03377 0.05937 ++ {0.0} {} 0 0.6325 0 {} 0 0 0 23 {48.h1'} 5.68429 0.01159 0.02137 ++ {0.0} {} {49.h6} 7.8679 0.03377 0.05937 ++ {0.0} {} 0 0.6325 0 {} 0 0 0 24 {48.h5} 5.78444 0.02027 0.04875 ++ {0.0} {} {48.h6} 7.97951 0.02591 0.05738 ++ {0.0} {} 0 1.522 0 {} 0 0 0 25 {48.h5} 5.55916 0.01321 0.00889 ++ {0.0} {} {47.h6} 7.98367 0.02521 0.01231 ++ {0.0} {} 0 0.1851 0 {} 0 0 0 26 {49.h1'} 6.0314 0.0235 0.03127 ++ {0.0} {} {50.h8} 8.5229 0.05423 0.06077 ++ {0.0} {} 0 0.2627 0 {} 0 0 0 27 {49.h1'} 6.02978 0.02002 0.04862 ++ {0.0} {} {49.h6} 7.86544 0.03705 0.07003 ++ {0.0} {} 0 2.6789 0 {} 0 0 0 28 {49.h5} 5.55751 0.02002 0.04862 ++ {0.0} {} {49.h6} 7.87546 0.03705 0.07003 ++ {0.0} {} 0 2.6789 0 {} 0 0 0 29 {50.h1'} 6.22947 0.00982 0.01474 ++ {0.0} {} {50.h8} 8.51181 0.02559 0.03726 ++ {0.0} {} 0 0.3291 0 {} 0 0 0 30 {50.h8} 6.23167 0.01694 0.0242 ++ {0.0} {} {51.h6} 7.81808 0.0258 0.03986 ++ {0.0} {} 0 0.4921 0 {} 0 0 0 31 {51.h1'} 6.26288 0.01261 0.01729 ++ {0.0} {} {50.h2} 7.33823 0.03191 0.04642 ++ {0.0} {} 0 0.3886 0 {} 0 0 0 32 {51.h1'} 5.59394 0.01408 0.01772 ++ {0.0} {} {51.h6} 7.82875 0.0372 0.04914 ++ {0.0} {} 0 0.3216 0 {} 0 0 0 33 {51.h1'} 5.59383 0.01114 0.01741 ++ {0.0} {} {52.h6} 7.93074 0.02491 0.03539 ++ {0.0} {} 0 0.3864 0 {} 0 0 0 34 {51.h5} 5.80103 0.01868 0.05043 ++ {0.0} {} {51.h6} 7.82271 0.03272 0.06245 ++ {0.0} {} 0 2.2174 0 {} 0 0 0 35 {52.h1'} 5.61505 0.00561 0.00561 ++ {0.0} {} {52.h6} 7.94733 0.0198 0.00551 ++ {0.0} {} 0 0.13 0 {} 0 0 0 36 {52.h1'} 5.61452 0.01263 0.02958 ++ {0.0} {} {53.h6} 7.97182 0.03413 0.05486 ++ {0.0} {} 0 0.6171 0 {} 0 0 0 37 {52.h5} 5.50473 0.01319 0.02187 ++ {0.0} {} {51.h6} 7.04364 0.0364 0.05528 ++ {0.0} {} 0 0.4775 -1 {} 0 0 0 38 {52.h5} 5.58626 0.01975 0.04149 ++ {0.0} {} {52.h6} 7.9348 0.03141 0.0664 ++ {0.0} {} 0 3.1416 0 {} 0 0 0 39 {53.h1'} 5.3653 0.01214 0.01507 ++ {0.0} {} {53.h6} 7.87002 0.02235 0.02814 ++ {0.0} {} 0 0.3775 0 {} 0 0 0 40 {53.h1'} 5.6827 0.01692 0.02921 ++ {0.0} {} {54.h6} 7.77615 0.03049 0.04802 ++ {0.0} {} 0 0.5741 0 {} 0 0 0 41 {53.h1'} 5.71142 0.01692 0.02921 ++ {0.0} {} {54.h6} 7.89858 0.03049 0.04802 ++ {0.0} {} 0 0.5741 0 {} 0 0 0 42 {53.h5} 5.46343 0.02271 0.05391 ++ {0.0} {} {53.h6} 7.95974 0.03085 0.06567 ++ {0.0} {} 0 1.6714 0 {} 0 0 0 43 {54.h1'} 5.71098 0.013 0.02177 ++ {0.0} {} {93.h2} 7.54061 0.02954 0.05076 ++ {0.0} {} 0 0.6866 0 {} 0 0 0 44 {54.h1'} 5.7116 0.01249 0.01767 ++ {0.0} {} {54.h6} 7.8965 0.03195 0.04527 ++ {0.0} {} 0 0.5088 0 {} 0 0 0 45 {54.h1'} 5.71121 0.01275 0.01963 ++ {0.0} {} {55.h6} 7.73703 0.03379 0.05193 ++ {0.0} {} 0 0.5602 0 {} 0 0 0 46 {54.h5} 5.74825 0.02076 0.03496 ++ {0.0} {} {54.h6} 7.89984 0.03955 0.0692 ++ {0.0} {} 0 1.8085 0 {} 0 0 0 47 {92.h1'} 5.96507 0.0191 0.02283 ++ {0.0} {} {93.h8} 7.71279 0.05365 0.05931 ++ {0.0} {} 0 0.3476 0 {} 0 0 0 48 {92.h1'} 5.96227 0.0191 0.02283 ++ {0.0} {} {92.h8} 7.74521 0.05365 0.05931 ++ {0.0} {} 0 0.3476 0 {} 0 0 0 49 {93.h1'} 5.94212 0.01356 0.02109 ++ {0.0} {} {94.h8} 7.02919 0.02765 0.03931 ++ {0.0} {} 0 0.4835 0 {} 0 0 0 50 {93.h1'} 5.94185 0.01144 0.02129 ++ {0.0} {} {92.h2} 7.16859 0.03171 0.05106 ++ {0.0} {} 0 0.6542 0 {} 0 0 0 51 {93.h1'} 5.94197 0.01494 0.01981 ++ {0.0} {} {93.h8} 7.71117 0.0263 0.0355 ++ {0.0} {} 0 0.4302 0 {} 0 0 0 52 {93.h1'} 5.94303 0.00916 0.00375 ++ {0.0} {} {93.h2} 7.54431 0.02501 0.00346 ++ {0.0} {} 0 0.1202 0 {} 0 0 0 53 {94.h1'} 5.61442 0.01358 0.03143 ++ {0.0} {} {94.h8} 7.03439 0.02429 0.04667 ++ {0.0} {} 0 1.2993 0 {} 0 0 0 54 {94.h1'} 5.61137 0.01399 0.02807 ++ {0.0} {} {93.h2} 7.54045 0.03289 0.05872 ++ {0.0} {} 0 0.8548 0 {} 0 0 0 55 {94.h1'} 5.61216 0.01358 0.03143 ++ {0.0} {} {95.h8} 7.02532 0.02429 0.04667 ++ {0.0} {} 0 1.2993 0 {} 0 0 0 56 {95.h1'} 5.73463 0.01256 0.02611 ++ {0.0} {} {95.h8} 7.01754 0.02626 0.04995 ++ {0.0} {} 0 1.0209 0 {} 0 0 0 57 {95.h1'} 5.73438 0.01261 0.01729 ++ {0.0} {} {96.h8} 7.917 0.03191 0.04642 ++ {0.0} {} 0 0.3886 0 {} 0 0 0 58 {96.h1'} 5.98208 0.01275 0.01831 ++ {0.0} {} {97.h8} 7.38759 0.03719 0.05737 ++ {0.0} {} 0 0.5236 0 {} 0 0 0 59 {96.h1'} 5.97889 0.00982 0.01317 ++ {0.0} {} {96.h8} 7.92153 0.02559 0.03378 ++ {0.0} {} 0 0.3291 0 {} 0 0 0 60 {97.h1'} 5.70635 0.01694 0.0242 ++ {0.0} {} {96.h2} 7.64656 0.0258 0.03986 ++ {0.0} {} 0 0.4921 0 {} 0 0 0 61 {97.h1'} 5.69884 0.01262 0.02322 ++ {0.0} {} {97.h8} 7.39507 0.02693 0.04793 ++ {0.0} {} 0 0.781 0 {} 0 0 0 62 {97.h1'} 5.69725 0.01272 0.01817 ++ {0.0} {} {98.h8} 7.11899 0.02529 0.03639 ++ {0.0} {} 0 0.3987 0 {} 0 0 0 63 {98.h1'} 5.79606 0.01402 0.0383 ++ {0.0} {} {99.h8} 7.29549 0.02296 0.04024 ++ {0.0} {} 0 0.9055 0 {} 0 0 0 64 {98.h1'} 5.78591 0.01272 0.01817 ++ {0.0} {} {98.h8} 7.11333 0.02529 0.03639 ++ {0.0} {} 0 0.3987 0 {} 0 0 0 65 {99.h1'} 5.80893 0.01501 0.02848 ++ {0.0} {} {99.h8} 7.3025 0.024 0.04036 ++ {0.0} {} 0 0.7024 0 {} 0 0 0 66 {99.h1'} 5.80148 0.01565 0.03129 ++ {0.0} {} {100.h6} 7.67589 0.02323 0.03887 ++ {0.0} {} 0 0.6857 0 {} 0 0 0 67 {53.h1'} 5.70588 0.00901 0.01234 ++ {0.0} {} {53.h6} 7.97896 0.01993 0.02736 ++ {0.0} {} 0 0.3161 0 {} 0 0 0 68 {53.h5} 5.52108 0.01823 0.04572 ++ {0.0} {} {53.h6} 7.97807 0.02034 0.03829 ++ {0.0} {} 0 1.6898 0 {} 0 0 0 69 {54.h1'} 5.75483 0.00982 0.01487 ++ {0.0} {} {93.h2} 7.57734 0.02675 0.04658 ++ {0.0} {} 0 0.3 0 {} 0 0 0 70 {54.h1'} 5.7573 0.02325 0.03837 ++ {0.0} {} {55.h6} 7.82628 0.03081 0.06454 ++ {0.0} {} 0 1.097 0 {} 0 0 0 71 {54.h1'} 5.75518 0.02008 0.06229 ++ {0.0} {} {54.h6} 8.06423 0.02561 0.05664 ++ {0.0} {} 0 1.9418 0 {} 0 0 0 72 {54.h5} 5.76122 0.02008 0.06229 ++ {0.0} {} {54.h6} 8.06655 0.02561 0.05664 ++ {0.0} {} 0 1.9418 0 {} 0 0 0 73 {54.h6} 5.70801 0.01318 0.01882 ++ {0.0} {} {53.h1} 8.07005 0.02605 0.04153 ++ {0.0} {} 0 0.4883 0 {} 0 0 0 74 {55.h1'} 5.69436 0.00793 0.00757 ++ {0.0} {} {92.h2} 7.19558 0.02063 0.01946 ++ {0.0} {} 0 0.1404 0 {} 0 0 0 75 {55.h1'} 5.69444 0.00549 0.00575 ++ {0.0} {} {55.h6} 7.81515 0.04362 0.04725 ++ {0.0} {} 0 0.1604 0 {} 0 0 0 76 {55.h5} 5.72949 0.02325 0.03837 ++ {0.0} {} {55.h6} 7.81926 0.03081 0.06454 ++ {0.0} {} 0 1.097 0 {} 0 0 0 77 {55.h5} 5.72265 0.0155 0.01694 ++ {0.0} {} {90.h2} 7.8605 0.03009 0.03503 ++ {0.0} {} 0 0.1896 0 {} 0 0 0 78 {56.h1'} 5.94234 0.01694 0.03496 ++ {0.0} {} {56.h8} 8.30042 0.03764 0.06609 ++ {0.0} {} 0 0.7161 0 {} 0 0 0 79 {56.h1'} 5.93751 0.01005 0.01028 ++ {0.0} {} {57.h6} 7.72856 0.0401 0.04115 ++ {0.0} {} 0 0.1628 0 {} 0 0 0 80 {57.h5} 5.52107 0.01919 0.05241 ++ {0.0} {} {57.h6} 7.73471 0.02462 0.05501 ++ {0.0} {} 0 2.8886 0 {} 0 0 0 81 {57.h5} 5.52216 0.00718 0.01276 ++ {0.0} {} {56.h8} 8.29684 0.03634 0.03109 ++ {0.0} {} 0 0.1385 0 {} 0 0 0 82 {59.h1'} 5.99427 0.01621 0.01528 ++ {0.0} {} {60.h6} 7.69532 0.04641 0.04562 ++ {0.0} {} 0 0.1929 0 {} 0 0 0 83 {59.h1'} 5.99384 0.0097 0.01364 ++ {0.0} {} {59.h8} 8.11563 0.03074 0.04284 ++ {0.0} {} 0 0.3267 0 {} 0 0 0 84 {60.h1'} 5.55571 0.01035 0.01299 ++ {0.0} {} {59.h2} 7.39435 0.03413 0.04253 ++ {0.0} {} 0 0.2459 0 {} 0 0 0 85 {60.h1'} 5.56545 0.01478 0.02156 ++ {0.0} {} {60.h6} 7.70348 0.04202 0.0479 ++ {0.0} {} 0 0.337 0 {} 0 0 0 86 {60.h5} 5.06998 0.02193 0.03948 ++ {0.0} {} {60.h6} 7.68309 0.03349 0.06439 ++ {0.0} {} 0 1.7173 0 {} 0 0 0 87 {60.h5} 5.08345 0.01764 0.01525 ++ {0.0} {} {59.h8} 8.1157 0.02556 0.02215 ++ {0.0} {} 0 0.1748 0 {} 0 0 0 88 {60.h6} 5.5551 0.01603 0.02789 ++ {0.0} {} {61.h8} 7.64681 0.03967 0.07159 ++ {0.0} {} 0 0.5089 0 {} 0 0 0 89 {85.h1'} 5.9357 0.00555 0.00386 ++ {0.0} {} {85.h6} 7.99838 0.04008 0.0272 ++ {0.0} {} 0 0.1403 -1 {} 0 0 0 90 {85.h1'} 6.00745 0.0097 0.01364 ++ {0.0} {} {85.h8} 8.15136 0.03074 0.04284 ++ {0.0} {} 0 0.3267 0 {} 0 0 0 91 {85.h1} 6.00602 0.01998 0.01904 ++ {0.0} {} {86.h6} 7.61162 0.02885 0.02669 ++ {0.0} {} 0 0.1725 0 {} 0 0 0 92 {86.h1'} 5.52017 0.01337 0.01521 ++ {0.0} {} {85.h2} 7.38103 0.03561 0.04166 ++ {0.0} {} 0 0.1826 0 {} 0 0 0 93 {86.h1'} 5.52325 0.01354 0.03699 ++ {0.0} {} {87.h8} 7.64652 0.0256 0.04705 ++ {0.0} {} 0 0.6173 0 {} 0 0 0 94 {86.h1'} 5.52076 0.0057 0.01527 ++ {0.0} {} {86.h6} 7.61326 0.04875 0.05787 ++ {0.0} {} 0 0.2195 0 {} 0 0 0 95 {86.h5} 5.11647 0.01802 0.02826 ++ {0.0} {} {86.h6} 7.61259 0.02459 0.04933 ++ {0.0} {} 0 1.2446 0 {} 0 0 0 96 {86.h5} 5.12018 0.02339 0.00922 ++ {0.0} {} {85.h8} 8.15015 0.0252 0.00655 ++ {0.0} {} 0 0.1139 0 {} 0 0 0 97 {87.h1'} 5.82106 0.01129 0.0144 ++ {0.0} {} {59.h2} 7.39063 0.0289 0.04027 ++ {0.0} {} 0 0.3057 0 {} 0 0 0 98 {87.h1'} 5.82875 0.01219 0.00965 ++ {0.0} {} {88.h8} 7.13909 0.03019 0.02075 ++ {0.0} {} 0 0.1766 0 {} 0 0 0 99 {87.h1'} 5.82524 0.01166 0.0143 ++ {0.0} {} {87.h8} 7.64504 0.02731 0.03678 ++ {0.0} {} 0 0.3548 0 {} 0 0 0 100 {88.h1'} 5.64282 0.01326 0.02252 ++ {0.0} {} {88.h8} 7.14144 0.03192 0.06475 ++ {0.0} {} 0 1.0105 0 {} 0 0 0 101 {89.h1'} 5.89778 0.01232 0.01623 ++ {0.0} {} {90.h8} 8.34218 0.02134 0.02819 ++ {0.0} {} 0 0.2918 0 {} 0 0 0 102 {89.h1'} 5.90239 0.01578 0.02069 ++ {0.0} {} {89.h6} 7.73649 0.03063 0.04111 ++ {0.0} {} 0 0.3174 0 {} 0 0 0 103 {89.h2'} 4.25741 0.01108 0.02127 ++ {0.0} {} {89.h6} 7.73846 0.02379 0.04693 ++ {0.0} {} 0 1.3794 0 {} 0 0 0 104 {89.h2'} 4.2575 0.02007 0.02697 ++ {0.0} {} {89.h1'} 5.89171 0.03322 0.04442 ++ {0.0} {} 0 0.2271 0 {} 0 0 0 105 {89.h2} 4.26233 0.01711 0.04616 ++ {0.0} {} {91.h8} 7.85708 0.02613 0.06126 ++ {0.0} {} 0 2.1833 0 {} 0 0 0 106 {89.h3'} 4.53916 0.01099 0.03304 ++ {0.0} {} {89.h6} 7.73945 0.02989 0.06102 ++ {0.0} {} 0 2.9163 0 {} 0 0 0 107 {89.h3} 4.5445 0.01443 0.01507 ++ {0.0} {} {89.h1'} 5.8995 0.04168 0.04675 ++ {0.0} {} 0 0.1733 0 {} 0 0 0 108 {89.h5} 5.56244 0.01005 0.01028 ++ {0.0} {} {89.h6} 7.73899 0.0401 0.04115 ++ {0.0} {} 0 0.1628 0 {} 0 0 0 109 {89.h5} 6.10821 0.01919 0.04937 ++ {0.0} {} {89.h6} 7.56241 0.02462 0.05418 ++ {0.0} {} 0 2.8886 -1 {} 0 0 0 110 {89.h6} 5.55043 0.01058 0.01102 ++ {0.0} {} {88.h8} 7.14714 0.02277 0.02368 ++ {0.0} {} 0 0.2064 0 {} 0 0 0 111 {90.h1'} 6.13057 0.01232 0.01845 ++ {0.0} {} {91.h8} 7.86049 0.02134 0.03109 ++ {0.0} {} 0 0.2918 0 {} 0 0 0 112 {90.h1} 6.13345 0.01397 0.03198 ++ {0.0} {} {90.h8} 8.33925 0.02583 0.04434 ++ {0.0} {} 0 0.5338 0 {} 0 0 0 113 {90.h2'} 4.35264 0.00941 0.01345 ++ {0.0} {} {90.h8} 8.3404 0.02492 0.05302 ++ {0.0} {} 0 1.432 0 {} 0 0 0 114 {90.h3'} 4.24885 0.01159 0.01465 ++ {0.0} {} {90.h8} 8.34232 0.02929 0.03623 ++ {0.0} {} 0 0.3246 0 {} 0 0 0 115 {91.h1} 5.3418 0.01325 0.02281 ++ {0.0} {} {91.h8} 7.87561 0.03584 0.05474 ++ {0.0} {} 0 0.9045 0 {} 0 0 0 116 {91.h2'} 4.80423 0.01269 0.01979 ++ {0.0} {} {91.h1} 5.31702 0.02306 0.03448 ++ {0.0} {} 0 0.3139 0 {} 0 0 0 117 {92.h1'} 6.11296 0.01367 0.01672 ++ {0.0} {} {93.h8} 7.55341 0.06763 0.09852 ++ {0.0} {} 0 0.1467 -1 {} 0 0 0 118 {92.h1'} 5.99914 0.01208 0.01758 ++ {0.0} {} {93.h8} 7.86632 0.04055 0.05212 ++ {0.0} {} 0 0.3115 0 {} 0 0 0 119 {92.h1} 5.99293 0.01208 0.01758 ++ {0.0} {} {92.h8} 7.87848 0.04055 0.05212 ++ {0.0} {} 0 0.3115 0 {} 0 0 0 120 {93.h1'} 6.00669 0.01227 0.01598 ++ {0.0} {} {92.h2} 7.20322 0.02416 0.03226 ++ {0.0} {} 0 0.2231 0 {} 0 0 0 121 {93.h1'} 6.00348 0.00987 0.00777 ++ {0.0} {} {94.h8} 7.0787 0.02158 0.01525 ++ {0.0} {} 0 0.1147 0 {} 0 0 0 122 {93.h1'} 6.07347 0.01367 0.01672 ++ {0.0} {} {93.h8} 7.58147 0.06763 0.09852 ++ {0.0} {} 0 0.1467 -1 {} 0 0 0 123 {93.h1} 6.01154 0.01422 0.01925 ++ {0.0} {} {93.h8} 7.86663 0.03276 0.04207 ++ {0.0} {} 0 0.2767 0 {} 0 0 0 124 {65.h1'} 6.05467 0.13315 0.08938 ++ {0.0} {} {66.h8} 7.65533 0.00694 0.0048 ++ {0.0} {} 0 3.2614 0 {} 0 0 0 125 {66.h1'} 5.77586 0.1292 0.19522 ++ {0.0} {} {66.h8} 7.65607 0.02198 0.0311 ++ {0.0} {} 0 13.0586 0 {} 0 0 0 126 {67.h5} 5.84639 0.14865 0.26977 ++ {0.0} {} {67.h6} 7.86916 0.02437 0.05781 ++ {0.0} {} 0 61.0753 0 {} 0 0 0 127 {67.h1'} 5.88921 0.14865 0.26977 ++ {0.0} {} {67.h6} 7.8704 0.02437 0.05781 ++ {0.0} {} 0 61.0753 0 {} 0 0 0 128 {72.h1'} 5.52451 0.10061 0.08996 ++ {0.0} {} {73.h6} 7.95427 0.01605 0.01422 ++ {0.0} {} 0 3.8134 0 {} 0 0 0 129 {68.h1'} 5.86964 0.15201 0.12545 ++ {0.0} {} {68.h8} 6.93479 0.03067 0.02156 ++ {0.0} {} 0 5.3134 0 {} 0 0 0 130 {67.h1'} 5.93428 0.15201 0.12545 ++ {0.0} {} {68.h8} 6.93987 0.03067 0.02156 ++ {0.0} {} 0 5.3134 0 {} 0 0 0 131 {68.h1'} 5.8512 0.18219 0.19541 ++ {0.0} {} {69.h8} 7.43648 0.01394 0.01582 ++ {0.0} {} 0 7.4857 0 {} 0 0 0 132 {69.h1'} 5.87472 0.18219 0.19541 ++ {0.0} {} {69.h8} 7.43785 0.01394 0.01582 ++ {0.0} {} 0 7.4857 0 {} 0 0 0 133 {70.h1'} 5.85437 0.15129 0.23261 ++ {0.0} {} {70.h6} 7.91667 0.03127 0.04743 ++ {0.0} {} 0 36.0065 0 {} 0 0 0 134 {69.h1'} 5.87184 0.15129 0.23261 ++ {0.0} {} {70.h6} 7.92111 0.03127 0.04743 ++ {0.0} {} 0 36.0065 0 {} 0 0 0 135 {70.h5} 5.89157 0.15129 0.23261 ++ {0.0} {} {70.h6} 7.91593 0.03127 0.04743 ++ {0.0} {} 0 36.0065 0 {} 0 0 0 136 {70.h1'} 5.8543 0.09109 0.09374 ++ {0.0} {} {71.h6} 7.70297 0.02017 0.02055 ++ {0.0} {} 0 8.5852 0 {} 0 0 0 137 {71.h5} 5.48244 0.14423 0.23218 ++ {0.0} {} {71.h6} 7.70438 0.02958 0.07467 ++ {0.0} {} 0 40.3682 0 {} 0 0 0 138 {71.h1'} 5.61591 0.14423 0.23218 ++ {0.0} {} {71.h6} 7.70857 0.02958 0.07467 ++ {0.0} {} 0 40.3682 0 {} 0 0 0 139 {72.h5} 5.54552 0.16265 0.23996 ++ {0.0} {} {72.h6} 7.78144 0.02965 0.04235 ++ {0.0} {} 0 21.1553 0 {} 0 0 0 140 {71.h1'} 5.61318 0.16265 0.23996 ++ {0.0} {} {72.h6} 7.79213 0.02965 0.04235 ++ {0.0} {} 0 21.1553 0 {} 0 0 0 141 {73.h1'} 6.0923 0.12544 0.16222 ++ {0.0} {} {73.h6} 7.94602 0.01575 0.02252 ++ {0.0} {} 0 12.9069 0 {} 0 0 0 142 {73.h5} 6.06005 0.13699 0.23815 ++ {0.0} {} {73.h6} 7.95582 0.02268 0.03996 ++ {0.0} {} 0 93.976 0 {} 0 0 0 143 {73.h1'} 6.08855 0.14978 0.21985 ++ {0.0} {} {74.h8} 7.81916 0.0164 0.02584 ++ {0.0} {} 0 17.5804 0 {} 0 0 0 144 {74.h1'} 6.10175 0.14978 0.21985 ++ {0.0} {} {74.h8} 7.81716 0.0164 0.02584 ++ {0.0} {} 0 17.5804 0 {} 0 0 0 145 {76.h1'} 5.8148 0.12968 0.11606 ++ {0.0} {} {76.h8} 6.89736 0.02459 0.02171 ++ {0.0} {} 0 7.3387 0 {} 0 0 0 146 {77.h5} 5.37953 0.16953 0.09683 ++ {0.0} {} {77.h6} 7.66613 0.02653 0.01073 ++ {0.0} {} 0 5.1529 0 {} 0 0 0 147 {76.h1'} 5.84731 0.12775 0.10194 ++ {0.0} {} {77.h6} 7.64631 0.01488 0.01307 ++ {0.0} {} 0 6.2262 0 {} 0 0 0 148 {77.h1'} 5.4055 0.19238 0.26117 ++ {0.0} {} {77.h6} 7.67486 0.00903 0.02895 ++ {0.0} {} 0 17.3313 0 {} 0 0 0 149 {77.h1} 5.41976 0.12876 0.13765 ++ {0.0} {} {78.h6} 7.83966 0.02262 0.02529 ++ {0.0} {} 0 9.4016 0 {} 0 0 0 150 {78.h5} 5.87506 0.14865 0.26567 ++ {0.0} {} {78.h6} 7.842 0.02437 0.05447 ++ {0.0} {} 0 61.0753 0 {} 0 0 0 151 {79.h1'} 5.87288 0.126 0.12678 ++ {0.0} {} {79.h8} 7.27875 0.01598 0.01615 ++ {0.0} {} 0 10.5055 0 {} 0 0 0 152 {78.h1'} 5.84187 0.126 0.1458 ++ {0.0} {} {79.h8} 7.28965 0.01598 0.01911 ++ {0.0} {} 0 10.5055 0 {} 0 0 0 153 {80.h5} 5.28922 0.10654 0.15941 ++ {0.0} {} {80.h6} 7.54986 0.02333 0.03975 ++ {0.0} {} 0 49.7994 0 {} 0 0 0 154 {80.h1'} 5.57359 0.0921 0.09244 ++ {0.0} {} {80.h6} 7.56544 0.02188 0.02197 ++ {0.0} {} 0 8.3833 0 {} 0 0 0 155 {79.h1'} 5.87825 0.09207 0.08524 ++ {0.0} {} {80.h6} 7.56325 0.02122 0.01987 ++ {0.0} {} 0 7.7598 0 {} 0 0 0 156 {76.h1'} 5.85419 0.01694 0.0242 ++ {0.0} {} {76.h8} 7.22246 0.11701 0.0585 ++ {0.0} {} 0 0.3035 0 {} 0 0 0 157 {75.h8} 5.55378 0.03071 0.01973 ++ {0.0} {} {76.h8} 7.22459 0.07882 0.06807 ++ {0.0} {} 0 0.4884 0 {} 0 0 0 158 {77.h5} 5.3867 0.00871 0.00966 ++ {0.0} {} {76.h8} 7.20678 0.08269 0.05125 ++ {0.0} {} 0 0.3943 0 {} 0 0 0 159 {78.h1'} 5.84152 0.01997 0.01775 ++ {0.0} {} {78.h6} 7.83801 0.05067 0.04164 ++ {0.0} {} 0 0.3286 0 {} 0 0 0 160 {72.h1'} 5.53108 0.03021 0.06885 ++ {0.0} {} {72.h6} 7.78224 0.05541 0.08355 ++ {0.0} {} 0 0.9468 0 {} 0 0 0 161 {60.h5} 5.09867 0.04407 0.05817 ++ {0.0} {} {60.h6} 7.70385 0.04469 0.06309 ++ {0.0} {} 0 1.1522 0 {} 0 0 0 162 {86.h5} 5.11635 0.03482 0.04324 ++ {0.0} {} {86.h6} 7.61508 0.0577 0.06994 ++ {0.0} {} 0 0.9557 0 {} 0 0 0 163 {86.h1'} 5.57252 0.041 0.02921 ++ {0.0} {} {86.h6} 7.61584 0.10235 0.07545 ++ {0.0} {} 0 0.6179 0 {} 0 0 0 164 {59.h1'} 5.8241 0.03574 0.05361 ++ {0.0} {} {59.h8} 8.2708 0.04844 0.11391 ++ {0.0} {} 0 0.6453 0 {} 0 0 0 165 {59.h1'} 5.81849 0.01208 0.01747 ++ {0.0} {} {60.h6} 7.69136 0.0669 0.03657 ++ {0.0} {} 0 0.406 0 {} 0 0 0 166 {85.h1'} 5.82311 0.03063 0.02572 ++ {0.0} {} {85.h8} 8.20309 0.04844 0.09706 ++ {0.0} {} 0 0.6453 0 {} 0 0 0 167 {86.h5} 5.10527 0.01931 0.01446 ++ {0.0} {} {85.h8} 8.20172 0.09202 0.0617 ++ {0.0} {} 0 0.4202 0 {} 0 0 0 168 {84.h1'} 5.74262 0.01578 0.02522 ++ {0.0} {} {85.h8} 8.19989 0.07767 0.06427 ++ {0.0} {} 0 0.4728 0 {} 0 0 0 169 {84.h1'} 5.74852 0.01694 0.0242 ++ {0.0} {} {84.h6} 8.0779 0.09527 0.07851 ++ {0.0} {} 0 0.476 0 {} 0 0 0 170 {84.h5} 5.81289 0.03021 0.05192 ++ {0.0} {} {84.h6} 8.07077 0.05541 0.07674 ++ {0.0} {} 0 0.9468 0 {} 0 0 0 171 {83.h1'} 5.72336 0.01084 0.01468 ++ {0.0} {} {84.h6} 8.06001 0.07433 0.04429 ++ {0.0} {} 0 0.505 0 {} 0 0 0 172 {83.h5} 5.99376 0.02447 0.03496 ++ {0.0} {} {83.h6} 8.06129 0.09637 0.11337 ++ {0.0} {} 0 0.97 0 {} 0 0 0 173 {83.h1'} 5.72344 0.02947 0.0421 ++ {0.0} {} {83.h6} 8.07651 0.09173 0.07215 ++ {0.0} {} 0 0.5681 0 {} 0 0 0 174 {82.h1'} 5.6814 0.01084 0.02023 ++ {0.0} {} {83.h6} 8.05875 0.07433 0.06395 ++ {0.0} {} 0 0.505 0 {} 0 0 0 175 {82.h1'} 5.63607 0.02447 0.03496 ++ {0.0} {} {82.h6} 7.88885 0.09637 0.12356 ++ {0.0} {} 0 0.97 0 {} 0 0 0 176 {82.h1'} 5.68128 0.0307 0.05428 ++ {0.0} {} {82.h6} 7.89476 0.05951 0.07477 ++ {0.0} {} 0 0.9033 0 {} 0 0 0 177 {81.h1'} 6.01341 0.03691 0.05168 ++ {0.0} {} {82.h6} 7.9168 0.13176 0.17755 ++ {0.0} {} 0 0.8912 0 {} 0 0 0 178 {81.h1'} 6.01341 0.03691 0.05168 ++ {0.0} {} {81.h8} 7.89009 0.13176 0.17755 ++ {0.0} {} 0 0.8912 0 {} 0 0 0 179 {60.h1'} 5.64686 0.02071 0.02958 ++ {0.0} {} {60.h6} 7.69558 0.09976 0.07968 ++ {0.0} {} 0 0.524 0 {} 0 0 0 180 {60.h1'} 5.64523 0.02447 0.03496 ++ {0.0} {} {61.h8} 7.80522 0.09637 0.11337 ++ {0.0} {} 0 0.97 0 {} 0 0 0 181 {61.h1'} 5.73728 0.02973 0.03515 ++ {0.0} {} {61.h8} 7.80185 0.14794 0.16072 ++ {0.0} {} 0 0.8969 0 {} 0 0 0 182 {61.h1'} 5.73728 0.02973 0.03515 ++ {0.0} {} {62.h6} 7.86361 0.14794 0.16072 ++ {0.0} {} 0 0.8969 0 {} 0 0 0 183 {62.h5} 5.70025 0.03762 0.11195 ++ {0.0} {} {62.h6} 7.86188 0.07942 0.21825 ++ {0.0} {} 0 1.1074 0 {} 0 0 0 184 {63.h1'} 6.16324 0.02675 0.05205 ++ {0.0} {} {63.h6} 8.22266 0.05681 0.10405 ++ {0.0} {} 0 2.4375 0 {} 0 0 0 185 {63.h1'} 5.71613 0.0307 0.04231 ++ {0.0} {} {63.h6} 8.2217 0.05951 0.06786 ++ {0.0} {} 0 0.9033 0 {} 0 0 0 ; loop_ _Spectral_dim.ID _Spectral_dim.Axis_code _Spectral_dim.Spectrometer_frequency _Spectral_dim.Atom_type _Spectral_dim.Atom_isotope_number _Spectral_dim.Spectral_region _Spectral_dim.Magnetization_linkage_ID _Spectral_dim.Under_sampling_type _Spectral_dim.Sweep_width _Spectral_dim.Sweep_width_units _Spectral_dim.Value_first_point _Spectral_dim.Absolute_peak_positions _Spectral_dim.Acquisition _Spectral_dim.Center_frequency_offset _Spectral_dim.Encoding_code _Spectral_dim.Encoded_reduced_dimension_ID _Spectral_dim.Entry_ID _Spectral_dim.Spectral_peak_list_ID 1 . . H 1 H . . 8012.820801 Hz . . . 4.706 . . 30816 2 2 . . H 1 H . . 8012.820801 Hz . . . 4.706 . . 30816 2 stop_ save_