data_30973 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 30973 _Entry.Title ; Solution structure of 7SK stem-loop 1 with HIV-1 Tat Finland Arginine Rich Motif ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-12-02 _Entry.Accession_date 2021-12-02 _Entry.Last_release_date 2022-02-07 _Entry.Original_release_date 2022-02-07 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 V. Pham V. V. . . 30973 2 M. Gao M. . . . 30973 3 V. D'Souza V. M. . . 30973 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 7SK . 30973 HIV-1 . 30973 TRANSCRIPTION . 30973 Tat . 30973 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 30973 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 219 30973 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-09-08 . original BMRB . 30973 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7T1P 'BMRB Entry Tracking System' 30973 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 30973 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 35970937 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; A structure-based mechanism for displacement of the HEXIM adapter from 7SK small nuclear RNA ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Commun. Biol.' _Citation.Journal_name_full 'Communications biology' _Citation.Journal_volume 5 _Citation.Journal_issue 1 _Citation.Journal_ASTM . _Citation.Journal_ISSN 2399-3642 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 819 _Citation.Page_last 819 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 V. Pham V. V. . . 30973 1 2 M. Gao M. . . . 30973 1 3 J. Meagher J. L. . . 30973 1 4 J. Smith J. L. . . 30973 1 5 V. D'Souza V. M. . . 30973 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 30973 _Assembly.ID 1 _Assembly.Name 'Tat Finland Arginine Rich Motif/RNA Complex' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 30973 1 2 unit_2 2 $entity_2 B B yes . . . . . . 30973 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 30973 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGAUCUGUCACCCCAUUGA UCGCCAGUGGCUGAUCUGGC UGGCUAGGCGGGUCCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 56 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 17986.635 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 24 G . 30973 1 2 25 G . 30973 1 3 26 G . 30973 1 4 27 A . 30973 1 5 28 U . 30973 1 6 29 C . 30973 1 7 30 U . 30973 1 8 31 G . 30973 1 9 32 U . 30973 1 10 33 C . 30973 1 11 34 A . 30973 1 12 35 C . 30973 1 13 36 C . 30973 1 14 37 C . 30973 1 15 38 C . 30973 1 16 39 A . 30973 1 17 40 U . 30973 1 18 41 U . 30973 1 19 42 G . 30973 1 20 43 A . 30973 1 21 44 U . 30973 1 22 45 C . 30973 1 23 46 G . 30973 1 24 47 C . 30973 1 25 48 C . 30973 1 26 49 A . 30973 1 27 50 G . 30973 1 28 51 U . 30973 1 29 60 G . 30973 1 30 61 G . 30973 1 31 62 C . 30973 1 32 63 U . 30973 1 33 64 G . 30973 1 34 65 A . 30973 1 35 66 U . 30973 1 36 67 C . 30973 1 37 68 U . 30973 1 38 69 G . 30973 1 39 70 G . 30973 1 40 71 C . 30973 1 41 72 U . 30973 1 42 73 G . 30973 1 43 74 G . 30973 1 44 75 C . 30973 1 45 76 U . 30973 1 46 77 A . 30973 1 47 78 G . 30973 1 48 79 G . 30973 1 49 80 C . 30973 1 50 81 G . 30973 1 51 82 G . 30973 1 52 83 G . 30973 1 53 84 U . 30973 1 54 85 C . 30973 1 55 86 C . 30973 1 56 87 C . 30973 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 30973 1 . G 2 2 30973 1 . G 3 3 30973 1 . A 4 4 30973 1 . U 5 5 30973 1 . C 6 6 30973 1 . U 7 7 30973 1 . G 8 8 30973 1 . U 9 9 30973 1 . C 10 10 30973 1 . A 11 11 30973 1 . C 12 12 30973 1 . C 13 13 30973 1 . C 14 14 30973 1 . C 15 15 30973 1 . A 16 16 30973 1 . U 17 17 30973 1 . U 18 18 30973 1 . G 19 19 30973 1 . A 20 20 30973 1 . U 21 21 30973 1 . C 22 22 30973 1 . G 23 23 30973 1 . C 24 24 30973 1 . C 25 25 30973 1 . A 26 26 30973 1 . G 27 27 30973 1 . U 28 28 30973 1 . G 29 29 30973 1 . G 30 30 30973 1 . C 31 31 30973 1 . U 32 32 30973 1 . G 33 33 30973 1 . A 34 34 30973 1 . U 35 35 30973 1 . C 36 36 30973 1 . U 37 37 30973 1 . G 38 38 30973 1 . G 39 39 30973 1 . C 40 40 30973 1 . U 41 41 30973 1 . G 42 42 30973 1 . G 43 43 30973 1 . C 44 44 30973 1 . U 45 45 30973 1 . A 46 46 30973 1 . G 47 47 30973 1 . G 48 48 30973 1 . C 49 49 30973 1 . G 50 50 30973 1 . G 51 51 30973 1 . G 52 52 30973 1 . U 53 53 30973 1 . C 54 54 30973 1 . C 55 55 30973 1 . C 56 56 30973 1 stop_ save_ save_entity_2 _Entity.Sf_category entity _Entity.Sf_framecode entity_2 _Entity.Entry_ID 30973 _Entity.ID 2 _Entity.BMRB_code . _Entity.Name entity_2 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polypeptide(L) _Entity.Polymer_type_details . _Entity.Polymer_strand_ID B _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GISYGRKKRKHRRRAHQ ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 17 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 2144.537 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 44 GLY . 30973 2 2 45 ILE . 30973 2 3 46 SER . 30973 2 4 47 TYR . 30973 2 5 48 GLY . 30973 2 6 49 ARG . 30973 2 7 50 LYS . 30973 2 8 51 LYS . 30973 2 9 52 ARG . 30973 2 10 53 LYS . 30973 2 11 54 HIS . 30973 2 12 55 ARG . 30973 2 13 56 ARG . 30973 2 14 57 ARG . 30973 2 15 58 ALA . 30973 2 16 59 HIS . 30973 2 17 60 GLN . 30973 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . GLY 1 1 30973 2 . ILE 2 2 30973 2 . SER 3 3 30973 2 . TYR 4 4 30973 2 . GLY 5 5 30973 2 . ARG 6 6 30973 2 . LYS 7 7 30973 2 . LYS 8 8 30973 2 . ARG 9 9 30973 2 . LYS 10 10 30973 2 . HIS 11 11 30973 2 . ARG 12 12 30973 2 . ARG 13 13 30973 2 . ARG 14 14 30973 2 . ALA 15 15 30973 2 . HIS 16 16 30973 2 . GLN 17 17 30973 2 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 30973 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 30973 1 2 2 $entity_2 . 587638 organism . 'HIV-1 06TG.HT008' HIV-1 . . Viruses . Lentivirus HIV-1 . . . . . . . . . . . . . 30973 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 30973 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30973 1 2 2 $entity_2 . 'chemical synthesis' . . . . . . . . . . . . . . . . 30973 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 30973 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM 7SK-SL1, 0.5 mM Tat Fin, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 7SK-SL1 'natural abundance' . . 1 $entity_1 . . 0.5 . . mM 0.2 . . . 30973 1 2 'Tat Fin' 'natural abundance' . . 2 $entity_2 . . 0.5 . . mM 0.2 . . . 30973 1 3 Phosphate 'natural abundance' . . . . . . 10 . . mM . . . . 30973 1 4 NaCl 'natural abundance' . . . . . . 70 . . mM . . . . 30973 1 5 EDTA 'natural abundance' . . . . . . 0.1 . . mM . . . . 30973 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 30973 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM 7SK-SL1, 0.5 mM Tat Fin, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 7SK-SL1 'natural abundance' . . 1 $entity_1 . . 0.5 . . mM 0.2 . . . 30973 2 2 'Tat Fin' 'natural abundance' . . 2 $entity_2 . . 0.5 . . mM 0.2 . . . 30973 2 3 Phosphate 'natural abundance' . . . . . . 10 . . mM . . . . 30973 2 4 NaCl 'natural abundance' . . . . . . 70 . . mM . . . . 30973 2 5 EDTA 'natural abundance' . . . . . . 0.1 . . mM . . . . 30973 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 30973 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 80 . mM 30973 1 pH 5.6 . pH 30973 1 pressure 100000 . Pa 30973 1 temperature 298 . K 30973 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 30973 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 80 . mM 30973 2 pH 5.6 . pH 30973 2 pressure 100000 . Pa 30973 2 temperature 298 . K 30973 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 30973 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 30973 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 30973 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 30973 _Software.ID 2 _Software.Type . _Software.Name NMRView _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Johnson, One Moon Scientific' . . 30973 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 30973 2 'peak picking' . 30973 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 30973 _Software.ID 3 _Software.Type . _Software.Name CYANA _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Guntert, Mumenthaler and Wuthrich' . . 30973 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'data analysis' . 30973 3 processing . 30973 3 'structure calculation' . 30973 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 30973 _Software.ID 4 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 30973 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 30973 4 'structure calculation' . 30973 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 30973 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DMX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 30973 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker DMX . 700 . . . 30973 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 30973 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30973 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 30973 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 30973 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . Hz 10000000 internal direct 1 . . . . . 30973 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 30973 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 30973 1 2 '2D 1H-1H NOESY' . . . 30973 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.5487 0.0000 . 1 . . . . A 24 G H1' . 30973 1 2 . 1 . 1 1 1 G H2' H 1 4.6380 0.0000 . 1 . . . . A 24 G H2' . 30973 1 3 . 1 . 1 1 1 G H8 H 1 7.9069 0.0000 . 1 . . . . A 24 G H8 . 30973 1 4 . 1 . 1 2 2 G H1 H 1 12.4298 0.0000 . 1 . . . . A 25 G H1 . 30973 1 5 . 1 . 1 2 2 G H1' H 1 5.6463 0.0000 . 1 . . . . A 25 G H1' . 30973 1 6 . 1 . 1 2 2 G H8 H 1 7.2927 0.0000 . 1 . . . . A 25 G H8 . 30973 1 7 . 1 . 1 3 3 G H1 H 1 12.0819 0.0000 . 1 . . . . A 26 G H1 . 30973 1 8 . 1 . 1 3 3 G H1' H 1 5.4974 0.0000 . 1 . . . . A 26 G H1' . 30973 1 9 . 1 . 1 3 3 G H8 H 1 6.9731 0.0000 . 1 . . . . A 26 G H8 . 30973 1 10 . 1 . 1 4 4 A H1' H 1 5.7127 0.0000 . 1 . . . . A 27 A H1' . 30973 1 11 . 1 . 1 4 4 A H2 H 1 7.6151 0.0000 . 1 . . . . A 27 A H2 . 30973 1 12 . 1 . 1 4 4 A H8 H 1 7.3901 0.0000 . 1 . . . . A 27 A H8 . 30973 1 13 . 1 . 1 5 5 U H1' H 1 5.0565 0.0000 . 1 . . . . A 28 U H1' . 30973 1 14 . 1 . 1 5 5 U H3 H 1 11.5921 0.0000 . 1 . . . . A 28 U H3 . 30973 1 15 . 1 . 1 5 5 U H5 H 1 5.0494 0.0000 . 1 . . . . A 28 U H5 . 30973 1 16 . 1 . 1 5 5 U H6 H 1 7.2764 0.0000 . 1 . . . . A 28 U H6 . 30973 1 17 . 1 . 1 6 6 C H1' H 1 5.1234 0.0000 . 1 . . . . A 29 C H1' . 30973 1 18 . 1 . 1 6 6 C H5 H 1 5.2788 0.0000 . 1 . . . . A 29 C H5 . 30973 1 19 . 1 . 1 6 6 C H6 H 1 7.5116 0.0000 . 1 . . . . A 29 C H6 . 30973 1 20 . 1 . 1 7 7 U H1' H 1 5.2328 0.0000 . 1 . . . . A 30 U H1' . 30973 1 21 . 1 . 1 7 7 U H3 H 1 11.3746 0.0000 . 1 . . . . A 30 U H3 . 30973 1 22 . 1 . 1 7 7 U H5 H 1 5.3133 0.0000 . 1 . . . . A 30 U H5 . 30973 1 23 . 1 . 1 7 7 U H6 H 1 7.4866 0.0000 . 1 . . . . A 30 U H6 . 30973 1 24 . 1 . 1 8 8 G H1 H 1 12.5539 0.0000 . 1 . . . . A 31 G H1 . 30973 1 25 . 1 . 1 8 8 G H1' H 1 5.4280 0.0000 . 1 . . . . A 31 G H1' . 30973 1 26 . 1 . 1 8 8 G H8 H 1 7.6093 0.0000 . 1 . . . . A 31 G H8 . 30973 1 27 . 1 . 1 9 9 U H3 H 1 11.8323 0.0000 . 1 . . . . A 32 U H3 . 30973 1 28 . 1 . 1 9 9 U H5 H 1 4.8961 0.0000 . 1 . . . . A 32 U H5 . 30973 1 29 . 1 . 1 9 9 U H6 H 1 7.3407 0.0000 . 1 . . . . A 32 U H6 . 30973 1 30 . 1 . 1 10 10 C H1' H 1 5.3796 0.0000 . 1 . . . . A 33 C H1' . 30973 1 31 . 1 . 1 10 10 C H5 H 1 5.2704 0.0000 . 1 . . . . A 33 C H5 . 30973 1 32 . 1 . 1 10 10 C H6 H 1 7.5916 0.0000 . 1 . . . . A 33 C H6 . 30973 1 33 . 1 . 1 11 11 A H1' H 1 5.5657 0.0000 . 1 . . . . A 34 A H1' . 30973 1 34 . 1 . 1 11 11 A H2 H 1 7.8897 0.0000 . 1 . . . . A 34 A H2 . 30973 1 35 . 1 . 1 11 11 A H8 H 1 7.9376 0.0000 . 1 . . . . A 34 A H8 . 30973 1 36 . 1 . 1 12 12 C H1' H 1 5.0572 0.0000 . 1 . . . . A 35 C H1' . 30973 1 37 . 1 . 1 12 12 C H5 H 1 4.8907 0.0000 . 1 . . . . A 35 C H5 . 30973 1 38 . 1 . 1 12 12 C H6 H 1 7.1154 0.0000 . 1 . . . . A 35 C H6 . 30973 1 39 . 1 . 1 13 13 C H1' H 1 5.2448 0.0000 . 1 . . . . A 36 C H1' . 30973 1 40 . 1 . 1 13 13 C H5 H 1 5.2212 0.0000 . 1 . . . . A 36 C H5 . 30973 1 41 . 1 . 1 13 13 C H6 H 1 7.0737 0.0000 . 1 . . . . A 36 C H6 . 30973 1 42 . 1 . 1 14 14 C H1' H 1 5.1784 0.0000 . 1 . . . . A 37 C H1' . 30973 1 43 . 1 . 1 14 14 C H5 H 1 5.2199 0.0000 . 1 . . . . A 37 C H5 . 30973 1 44 . 1 . 1 14 14 C H6 H 1 7.5390 0.0000 . 1 . . . . A 37 C H6 . 30973 1 45 . 1 . 1 15 15 C H1' H 1 4.9327 0.0000 . 1 . . . . A 38 C H1' . 30973 1 46 . 1 . 1 15 15 C H5 H 1 5.2422 0.0000 . 1 . . . . A 38 C H5 . 30973 1 47 . 1 . 1 15 15 C H6 H 1 7.3630 0.0000 . 1 . . . . A 38 C H6 . 30973 1 48 . 1 . 1 16 16 A H1' H 1 5.5985 0.0000 . 1 . . . . A 39 A H1' . 30973 1 49 . 1 . 1 16 16 A H2 H 1 6.3586 0.0000 . 1 . . . . A 39 A H2 . 30973 1 50 . 1 . 1 16 16 A H8 H 1 7.7172 0.0000 . 1 . . . . A 39 A H8 . 30973 1 51 . 1 . 1 17 17 U H1' H 1 5.7225 0.0000 . 1 . . . . A 40 U H1' . 30973 1 52 . 1 . 1 17 17 U H3 H 1 11.5519 0.0000 . 1 . . . . A 40 U H3 . 30973 1 53 . 1 . 1 17 17 U H5 H 1 5.4840 0.0000 . 1 . . . . A 40 U H5 . 30973 1 54 . 1 . 1 17 17 U H6 H 1 7.6084 0.0000 . 1 . . . . A 40 U H6 . 30973 1 55 . 1 . 1 18 18 U H1' H 1 5.4114 0.0000 . 1 . . . . A 41 U H1' . 30973 1 56 . 1 . 1 18 18 U H5 H 1 5.4306 0.0000 . 1 . . . . A 41 U H5 . 30973 1 57 . 1 . 1 18 18 U H6 H 1 7.5939 0.0000 . 1 . . . . A 41 U H6 . 30973 1 58 . 1 . 1 19 19 G H1 H 1 11.8268 0.0000 . 1 . . . . A 42 G H1 . 30973 1 59 . 1 . 1 19 19 G H1' H 1 5.5474 0.0000 . 1 . . . . A 42 G H1' . 30973 1 60 . 1 . 1 19 19 G H8 H 1 7.5040 0.0000 . 1 . . . . A 42 G H8 . 30973 1 61 . 1 . 1 20 20 A H1' H 1 5.8089 0.0000 . 1 . . . . A 43 A H1' . 30973 1 62 . 1 . 1 20 20 A H2 H 1 7.7509 0.0000 . 1 . . . . A 43 A H2 . 30973 1 63 . 1 . 1 20 20 A H8 H 1 7.6177 0.0000 . 1 . . . . A 43 A H8 . 30973 1 64 . 1 . 1 21 21 U H1' H 1 5.3461 0.0000 . 1 . . . . A 44 U H1' . 30973 1 65 . 1 . 1 21 21 U H3 H 1 13.6807 0.0000 . 1 . . . . A 44 U H3 . 30973 1 66 . 1 . 1 21 21 U H5 H 1 4.6777 0.0000 . 1 . . . . A 44 U H5 . 30973 1 67 . 1 . 1 21 21 U H6 H 1 7.0581 0.0000 . 1 . . . . A 44 U H6 . 30973 1 68 . 1 . 1 22 22 C H1' H 1 5.1762 0.0000 . 1 . . . . A 45 C H1' . 30973 1 69 . 1 . 1 22 22 C H5 H 1 5.2953 0.0000 . 1 . . . . A 45 C H5 . 30973 1 70 . 1 . 1 22 22 C H6 H 1 7.5341 0.0000 . 1 . . . . A 45 C H6 . 30973 1 71 . 1 . 1 23 23 G H1 H 1 12.0830 0.0000 . 1 . . . . A 46 G H1 . 30973 1 72 . 1 . 1 23 23 G H1' H 1 5.3402 0.0000 . 1 . . . . A 46 G H1' . 30973 1 73 . 1 . 1 23 23 G H8 H 1 7.1157 0.0000 . 1 . . . . A 46 G H8 . 30973 1 74 . 1 . 1 24 24 C H1' H 1 5.1369 0.0000 . 1 . . . . A 47 C H1' . 30973 1 75 . 1 . 1 24 24 C H5 H 1 4.8856 0.0000 . 1 . . . . A 47 C H5 . 30973 1 76 . 1 . 1 24 24 C H6 H 1 7.4424 0.0000 . 1 . . . . A 47 C H6 . 30973 1 77 . 1 . 1 25 25 C H1' H 1 5.2609 0.0000 . 1 . . . . A 48 C H1' . 30973 1 78 . 1 . 1 25 25 C H5 H 1 5.1989 0.0000 . 1 . . . . A 48 C H5 . 30973 1 79 . 1 . 1 25 25 C H6 H 1 7.4665 0.0000 . 1 . . . . A 48 C H6 . 30973 1 80 . 1 . 1 26 26 A H1' H 1 5.3099 0.0000 . 1 . . . . A 49 A H1' . 30973 1 81 . 1 . 1 27 27 G H1' H 1 5.5889 0.0000 . 1 . . . . A 50 G H1' . 30973 1 82 . 1 . 1 27 27 G H8 H 1 7.8101 0.0000 . 1 . . . . A 50 G H8 . 30973 1 83 . 1 . 1 28 28 U H1' H 1 5.0393 0.0000 . 1 . . . . A 51 U H1' . 30973 1 84 . 1 . 1 29 29 G H1 H 1 12.2899 0.0000 . 1 . . . . A 60 G H1 . 30973 1 85 . 1 . 1 29 29 G H1' H 1 5.4958 0.0000 . 1 . . . . A 60 G H1' . 30973 1 86 . 1 . 1 29 29 G H8 H 1 7.7002 0.0000 . 1 . . . . A 60 G H8 . 30973 1 87 . 1 . 1 30 30 G H1 H 1 12.9880 0.0000 . 1 . . . . A 61 G H1 . 30973 1 88 . 1 . 1 30 30 G H1' H 1 5.5140 0.0000 . 1 . . . . A 61 G H1' . 30973 1 89 . 1 . 1 30 30 G H8 H 1 6.9020 0.0000 . 1 . . . . A 61 G H8 . 30973 1 90 . 1 . 1 31 31 C H1' H 1 5.2179 0.0000 . 1 . . . . A 62 C H1' . 30973 1 91 . 1 . 1 31 31 C H5 H 1 4.7597 0.0000 . 1 . . . . A 62 C H5 . 30973 1 92 . 1 . 1 31 31 C H6 H 1 7.1182 0.0000 . 1 . . . . A 62 C H6 . 30973 1 93 . 1 . 1 32 32 U H1' H 1 5.7185 0.0000 . 1 . . . . A 63 U H1' . 30973 1 94 . 1 . 1 32 32 U H3 H 1 10.2926 0.0000 . 1 . . . . A 63 U H3 . 30973 1 95 . 1 . 1 32 32 U H5 H 1 5.4315 0.0000 . 1 . . . . A 63 U H5 . 30973 1 96 . 1 . 1 32 32 U H6 H 1 7.5723 0.0000 . 1 . . . . A 63 U H6 . 30973 1 97 . 1 . 1 33 33 G H1 H 1 11.8047 0.0000 . 1 . . . . A 64 G H1 . 30973 1 98 . 1 . 1 33 33 G H1' H 1 5.7055 0.0000 . 1 . . . . A 64 G H1' . 30973 1 99 . 1 . 1 33 33 G H8 H 1 7.6761 0.0000 . 1 . . . . A 64 G H8 . 30973 1 100 . 1 . 1 34 34 A H1' H 1 5.7898 0.0000 . 1 . . . . A 65 A H1' . 30973 1 101 . 1 . 1 34 34 A H2 H 1 7.5645 0.0000 . 1 . . . . A 65 A H2 . 30973 1 102 . 1 . 1 34 34 A H8 H 1 7.6173 0.0000 . 1 . . . . A 65 A H8 . 30973 1 103 . 1 . 1 35 35 U H1' H 1 5.4668 0.0000 . 1 . . . . A 66 U H1' . 30973 1 104 . 1 . 1 35 35 U H3 H 1 13.8807 0.0000 . 1 . . . . A 66 U H3 . 30973 1 105 . 1 . 1 35 35 U H5 H 1 5.3039 0.0000 . 1 . . . . A 66 U H5 . 30973 1 106 . 1 . 1 35 35 U H6 H 1 7.2570 0.0000 . 1 . . . . A 66 U H6 . 30973 1 107 . 1 . 1 36 36 C H1' H 1 4.8861 0.0000 . 1 . . . . A 67 C H1' . 30973 1 108 . 1 . 1 36 36 C H5 H 1 5.1016 0.0000 . 1 . . . . A 67 C H5 . 30973 1 109 . 1 . 1 36 36 C H6 H 1 7.1448 0.0000 . 1 . . . . A 67 C H6 . 30973 1 110 . 1 . 1 37 37 U H1' H 1 5.4673 0.0000 . 1 . . . . A 68 U H1' . 30973 1 111 . 1 . 1 37 37 U H3 H 1 13.0457 0.0000 . 1 . . . . A 68 U H3 . 30973 1 112 . 1 . 1 37 37 U H5 H 1 5.0544 0.0000 . 1 . . . . A 68 U H5 . 30973 1 113 . 1 . 1 37 37 U H6 H 1 7.5957 0.0000 . 1 . . . . A 68 U H6 . 30973 1 114 . 1 . 1 38 38 G H1 H 1 12.2694 0.0000 . 1 . . . . A 69 G H1 . 30973 1 115 . 1 . 1 38 38 G H1' H 1 5.2932 0.0000 . 1 . . . . A 69 G H1' . 30973 1 116 . 1 . 1 38 38 G H8 H 1 6.4649 0.0000 . 1 . . . . A 69 G H8 . 30973 1 117 . 1 . 1 39 39 G H1 H 1 12.4115 0.0000 . 1 . . . . A 70 G H1 . 30973 1 118 . 1 . 1 39 39 G H1' H 1 5.5178 0.0000 . 1 . . . . A 70 G H1' . 30973 1 119 . 1 . 1 39 39 G H8 H 1 7.0133 0.0000 . 1 . . . . A 70 G H8 . 30973 1 120 . 1 . 1 40 40 C H1' H 1 5.7652 0.0000 . 1 . . . . A 71 C H1' . 30973 1 121 . 1 . 1 40 40 C H5 H 1 5.6787 0.0000 . 1 . . . . A 71 C H5 . 30973 1 122 . 1 . 1 40 40 C H6 H 1 7.4224 0.0000 . 1 . . . . A 71 C H6 . 30973 1 123 . 1 . 1 41 41 U H1' H 1 5.7014 0.0000 . 1 . . . . A 72 U H1' . 30973 1 124 . 1 . 1 41 41 U H5 H 1 5.6443 0.0000 . 1 . . . . A 72 U H5 . 30973 1 125 . 1 . 1 41 41 U H6 H 1 7.5669 0.0000 . 1 . . . . A 72 U H6 . 30973 1 126 . 1 . 1 42 42 G H1 H 1 12.0736 0.0000 . 1 . . . . A 73 G H1 . 30973 1 127 . 1 . 1 42 42 G H1' H 1 5.4878 0.0000 . 1 . . . . A 73 G H1' . 30973 1 128 . 1 . 1 42 42 G H8 H 1 7.2861 0.0000 . 1 . . . . A 73 G H8 . 30973 1 129 . 1 . 1 43 43 G H1 H 1 12.9667 0.0000 . 1 . . . . A 74 G H1 . 30973 1 130 . 1 . 1 43 43 G H1' H 1 5.6040 0.0000 . 1 . . . . A 74 G H1' . 30973 1 131 . 1 . 1 43 43 G H8 H 1 7.3362 0.0000 . 1 . . . . A 74 G H8 . 30973 1 132 . 1 . 1 44 44 C H1' H 1 5.5145 0.0000 . 1 . . . . A 75 C H1' . 30973 1 133 . 1 . 1 44 44 C H5 H 1 5.1357 0.0000 . 1 . . . . A 75 C H5 . 30973 1 134 . 1 . 1 44 44 C H6 H 1 7.3570 0.0000 . 1 . . . . A 75 C H6 . 30973 1 135 . 1 . 1 45 45 U H1' H 1 5.5970 0.0000 . 1 . . . . A 76 U H1' . 30973 1 136 . 1 . 1 45 45 U H5 H 1 5.5137 0.0000 . 1 . . . . A 76 U H5 . 30973 1 137 . 1 . 1 45 45 U H6 H 1 7.5185 0.0000 . 1 . . . . A 76 U H6 . 30973 1 138 . 1 . 1 46 46 A H1' H 1 5.8096 0.0000 . 1 . . . . A 77 A H1' . 30973 1 139 . 1 . 1 46 46 A H8 H 1 8.0828 0.0000 . 1 . . . . A 77 A H8 . 30973 1 140 . 1 . 1 47 47 G H1 H 1 12.0748 0.0000 . 1 . . . . A 78 G H1 . 30973 1 141 . 1 . 1 47 47 G H1' H 1 5.5598 0.0000 . 1 . . . . A 78 G H1' . 30973 1 142 . 1 . 1 47 47 G H8 H 1 7.7215 0.0000 . 1 . . . . A 78 G H8 . 30973 1 143 . 1 . 1 48 48 G H1 H 1 11.0446 0.0000 . 1 . . . . A 79 G H1 . 30973 1 144 . 1 . 1 48 48 G H1' H 1 5.2991 0.0000 . 1 . . . . A 79 G H1' . 30973 1 145 . 1 . 1 48 48 G H8 H 1 7.1872 0.0000 . 1 . . . . A 79 G H8 . 30973 1 146 . 1 . 1 49 49 C H1' H 1 5.1053 0.0000 . 1 . . . . A 80 C H1' . 30973 1 147 . 1 . 1 49 49 C H5 H 1 5.0511 0.0000 . 1 . . . . A 80 C H5 . 30973 1 148 . 1 . 1 49 49 C H6 H 1 7.2714 0.0000 . 1 . . . . A 80 C H6 . 30973 1 149 . 1 . 1 50 50 G H1 H 1 10.0636 0.0000 . 1 . . . . A 81 G H1 . 30973 1 150 . 1 . 1 50 50 G H1' H 1 5.4653 0.0000 . 1 . . . . A 81 G H1' . 30973 1 151 . 1 . 1 50 50 G H8 H 1 7.0921 0.0000 . 1 . . . . A 81 G H8 . 30973 1 152 . 1 . 1 51 51 G H1 H 1 12.4245 0.0000 . 1 . . . . A 82 G H1 . 30973 1 153 . 1 . 1 51 51 G H1' H 1 5.4804 0.0000 . 1 . . . . A 82 G H1' . 30973 1 154 . 1 . 1 51 51 G H8 H 1 6.9828 0.0000 . 1 . . . . A 82 G H8 . 30973 1 155 . 1 . 1 52 52 G H1 H 1 11.1998 0.0000 . 1 . . . . A 83 G H1 . 30973 1 156 . 1 . 1 52 52 G H1' H 1 5.5111 0.0000 . 1 . . . . A 83 G H1' . 30973 1 157 . 1 . 1 52 52 G H8 H 1 6.9301 0.0000 . 1 . . . . A 83 G H8 . 30973 1 158 . 1 . 1 53 53 U H1' H 1 5.1790 0.0000 . 1 . . . . A 84 U H1' . 30973 1 159 . 1 . 1 53 53 U H3 H 1 14.1231 0.0000 . 1 . . . . A 84 U H3 . 30973 1 160 . 1 . 1 53 53 U H5 H 1 4.8889 0.0000 . 1 . . . . A 84 U H5 . 30973 1 161 . 1 . 1 53 53 U H6 H 1 7.5297 0.0000 . 1 . . . . A 84 U H6 . 30973 1 162 . 1 . 1 54 54 C H1' H 1 5.3005 0.0000 . 1 . . . . A 85 C H1' . 30973 1 163 . 1 . 1 54 54 C H5 H 1 5.3425 0.0000 . 1 . . . . A 85 C H5 . 30973 1 164 . 1 . 1 54 54 C H6 H 1 7.6714 0.0000 . 1 . . . . A 85 C H6 . 30973 1 165 . 1 . 1 55 55 C H1' H 1 5.2623 0.0000 . 1 . . . . A 86 C H1' . 30973 1 166 . 1 . 1 55 55 C H5 H 1 5.1783 0.0000 . 1 . . . . A 86 C H5 . 30973 1 167 . 1 . 1 55 55 C H6 H 1 7.5675 0.0000 . 1 . . . . A 86 C H6 . 30973 1 168 . 1 . 1 56 56 C H1' H 1 5.4310 0.0000 . 1 . . . . A 87 C H1' . 30973 1 169 . 1 . 1 56 56 C H5 H 1 5.2009 0.0000 . 1 . . . . A 87 C H5 . 30973 1 170 . 1 . 1 56 56 C H6 H 1 7.4110 0.0000 . 1 . . . . A 87 C H6 . 30973 1 171 . 2 . 2 2 2 ILE HA H 1 3.8774 0.0000 . 1 . . . . B 45 ILE HA . 30973 1 172 . 2 . 2 2 2 ILE HB H 1 1.3876 0.0000 . 1 . . . . B 45 ILE HB . 30973 1 173 . 2 . 2 2 2 ILE HG12 H 1 1.0672 0.0000 . 2 . . . . B 45 ILE HG12 . 30973 1 174 . 2 . 2 3 3 SER HA H 1 4.1828 0.0000 . 1 . . . . B 46 SER HA . 30973 1 175 . 2 . 2 3 3 SER HB2 H 1 3.5203 0.0000 . 2 . . . . B 46 SER HB2 . 30973 1 176 . 2 . 2 4 4 TYR HA H 1 4.1699 0.0000 . 1 . . . . B 47 TYR HA . 30973 1 177 . 2 . 2 4 4 TYR HB2 H 1 2.8965 0.0000 . 2 . . . . B 47 TYR HB2 . 30973 1 178 . 2 . 2 4 4 TYR HD1 H 1 7.0293 0.0000 . 3 . . . . B 47 TYR HD1 . 30973 1 179 . 2 . 2 4 4 TYR HD2 H 1 7.0179 0.0000 . 3 . . . . B 47 TYR HD2 . 30973 1 180 . 2 . 2 4 4 TYR HE1 H 1 6.7888 0.0000 . 3 . . . . B 47 TYR HE1 . 30973 1 181 . 2 . 2 4 4 TYR HE2 H 1 6.7821 0.0000 . 3 . . . . B 47 TYR HE2 . 30973 1 182 . 2 . 2 6 6 ARG HA H 1 3.9551 0.0000 . 1 . . . . B 49 ARG HA . 30973 1 183 . 2 . 2 6 6 ARG HB2 H 1 1.4133 0.0000 . 2 . . . . B 49 ARG HB2 . 30973 1 184 . 2 . 2 6 6 ARG HG2 H 1 1.3279 0.0000 . 2 . . . . B 49 ARG HG2 . 30973 1 185 . 2 . 2 6 6 ARG HD2 H 1 2.6556 0.0000 . 2 . . . . B 49 ARG HD2 . 30973 1 186 . 2 . 2 7 7 LYS HA H 1 3.9252 0.0000 . 1 . . . . B 50 LYS HA . 30973 1 187 . 2 . 2 7 7 LYS HB2 H 1 1.3986 0.0000 . 2 . . . . B 50 LYS HB2 . 30973 1 188 . 2 . 2 7 7 LYS HG2 H 1 1.0537 0.0000 . 2 . . . . B 50 LYS HG2 . 30973 1 189 . 2 . 2 7 7 LYS HD2 H 1 1.3145 0.0000 . 2 . . . . B 50 LYS HD2 . 30973 1 190 . 2 . 2 7 7 LYS HE2 H 1 2.6599 0.0000 . 2 . . . . B 50 LYS HE2 . 30973 1 191 . 2 . 2 8 8 LYS HA H 1 3.9494 0.0000 . 1 . . . . B 51 LYS HA . 30973 1 192 . 2 . 2 8 8 LYS HB2 H 1 1.4438 0.0000 . 2 . . . . B 51 LYS HB2 . 30973 1 193 . 2 . 2 8 8 LYS HG2 H 1 1.0724 0.0000 . 2 . . . . B 51 LYS HG2 . 30973 1 194 . 2 . 2 8 8 LYS HD2 H 1 1.3404 0.0000 . 2 . . . . B 51 LYS HD2 . 30973 1 195 . 2 . 2 8 8 LYS HE2 H 1 2.6353 0.0000 . 2 . . . . B 51 LYS HE2 . 30973 1 196 . 2 . 2 9 9 ARG HA H 1 3.8533 0.0000 . 1 . . . . B 52 ARG HA . 30973 1 197 . 2 . 2 9 9 ARG HB2 H 1 1.4127 0.0000 . 2 . . . . B 52 ARG HB2 . 30973 1 198 . 2 . 2 9 9 ARG HG2 H 1 1.3262 0.0000 . 2 . . . . B 52 ARG HG2 . 30973 1 199 . 2 . 2 9 9 ARG HD2 H 1 2.9158 0.0000 . 2 . . . . B 52 ARG HD2 . 30973 1 200 . 2 . 2 10 10 LYS HA H 1 3.8277 0.0000 . 1 . . . . B 53 LYS HA . 30973 1 201 . 2 . 2 10 10 LYS HB2 H 1 1.4235 0.0000 . 2 . . . . B 53 LYS HB2 . 30973 1 202 . 2 . 2 10 10 LYS HG2 H 1 1.0689 0.0000 . 2 . . . . B 53 LYS HG2 . 30973 1 203 . 2 . 2 10 10 LYS HE2 H 1 2.6993 0.0000 . 2 . . . . B 53 LYS HE2 . 30973 1 204 . 2 . 2 11 11 HIS HA H 1 4.1832 0.0000 . 1 . . . . B 54 HIS HA . 30973 1 205 . 2 . 2 11 11 HIS HB2 H 1 2.9112 0.0000 . 2 . . . . B 54 HIS HB2 . 30973 1 206 . 2 . 2 12 12 ARG HA H 1 3.8139 0.0000 . 1 . . . . B 55 ARG HA . 30973 1 207 . 2 . 2 12 12 ARG HB2 H 1 1.4143 0.0000 . 2 . . . . B 55 ARG HB2 . 30973 1 208 . 2 . 2 12 12 ARG HG2 H 1 1.3420 0.0000 . 2 . . . . B 55 ARG HG2 . 30973 1 209 . 2 . 2 12 12 ARG HD2 H 1 2.9326 0.0000 . 2 . . . . B 55 ARG HD2 . 30973 1 210 . 2 . 2 13 13 ARG HA H 1 3.8770 0.0000 . 1 . . . . B 56 ARG HA . 30973 1 211 . 2 . 2 13 13 ARG HB2 H 1 1.4108 0.0000 . 2 . . . . B 56 ARG HB2 . 30973 1 212 . 2 . 2 13 13 ARG HG2 H 1 1.3325 0.0000 . 2 . . . . B 56 ARG HG2 . 30973 1 213 . 2 . 2 13 13 ARG HD2 H 1 2.9244 0.0000 . 2 . . . . B 56 ARG HD2 . 30973 1 214 . 2 . 2 16 16 HIS HA H 1 3.8840 0.0000 . 1 . . . . B 59 HIS HA . 30973 1 215 . 2 . 2 16 16 HIS HB2 H 1 2.9181 0.0000 . 2 . . . . B 59 HIS HB2 . 30973 1 216 . 2 . 2 16 16 HIS HE1 H 1 8.1073 0.0000 . 1 . . . . B 59 HIS HE1 . 30973 1 217 . 2 . 2 17 17 GLN HA H 1 3.9591 0.0000 . 1 . . . . B 60 GLN HA . 30973 1 218 . 2 . 2 17 17 GLN HB2 H 1 1.6448 0.0000 . 2 . . . . B 60 GLN HB2 . 30973 1 219 . 2 . 2 17 17 GLN HG2 H 1 1.9281 0.0000 . 2 . . . . B 60 GLN HG2 . 30973 1 stop_ save_