data_31078 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 31078 _Entry.Title ; TCEI_III NMR Structure ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2023-04-05 _Entry.Accession_date 2023-04-05 _Entry.Last_release_date 2023-05-01 _Entry.Original_release_date 2023-05-01 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 M. Warden M. S. . . 31078 2 G. Mueller G. A. . . 31078 3 T. Hall T. M.T. . . 31078 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID Glorund . 31078 RNA . 31078 TCEI_III . 31078 'control element' . 31078 nanos . 31078 nos . 31078 qRRM . 31078 translation . 31078 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 31078 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 17 31078 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2023-09-08 2023-04-05 update BMRB 'update entry citation' 31078 1 . . 2023-07-05 2023-04-05 original author 'original release' 31078 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 8SCH 'BMRB Entry Tracking System' 31078 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 31078 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 37427795 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; The translational repressor Glorund uses interchangeable RNA recognition domains to recognize Drosophila nanos ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 51 _Citation.Journal_issue 16 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 8836 _Citation.Page_last 8849 _Citation.Year 2023 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 M. Warden M. S. . . 31078 1 2 E. DeRose E. F. . . 31078 1 3 J. Tamayo J. V. . . 31078 1 4 G. Mueller G. A. . . 31078 1 5 E. Gavis E. R. . . 31078 1 6 T. Hall T. M.T. . . 31078 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 31078 _Assembly.ID 1 _Assembly.Name 'RNA (68-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 31078 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 31078 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GAGAAUCCAGCUCUGGAAGC GUUUAUAUAACAUGAAAUAU AUAUACGCAUUCCGAUCAAA GCUGGGUU ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 68 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 21838.988 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 31078 1 2 . A . 31078 1 3 . G . 31078 1 4 . A . 31078 1 5 . A . 31078 1 6 . U . 31078 1 7 . C . 31078 1 8 . C . 31078 1 9 . A . 31078 1 10 . G . 31078 1 11 . C . 31078 1 12 . U . 31078 1 13 . C . 31078 1 14 . U . 31078 1 15 . G . 31078 1 16 . G . 31078 1 17 . A . 31078 1 18 . A . 31078 1 19 . G . 31078 1 20 . C . 31078 1 21 . G . 31078 1 22 . U . 31078 1 23 . U . 31078 1 24 . U . 31078 1 25 . A . 31078 1 26 . U . 31078 1 27 . A . 31078 1 28 . U . 31078 1 29 . A . 31078 1 30 . A . 31078 1 31 . C . 31078 1 32 . A . 31078 1 33 . U . 31078 1 34 . G . 31078 1 35 . A . 31078 1 36 . A . 31078 1 37 . A . 31078 1 38 . U . 31078 1 39 . A . 31078 1 40 . U . 31078 1 41 . A . 31078 1 42 . U . 31078 1 43 . A . 31078 1 44 . U . 31078 1 45 . A . 31078 1 46 . C . 31078 1 47 . G . 31078 1 48 . C . 31078 1 49 . A . 31078 1 50 . U . 31078 1 51 . U . 31078 1 52 . C . 31078 1 53 . C . 31078 1 54 . G . 31078 1 55 . A . 31078 1 56 . U . 31078 1 57 . C . 31078 1 58 . A . 31078 1 59 . A . 31078 1 60 . A . 31078 1 61 . G . 31078 1 62 . C . 31078 1 63 . U . 31078 1 64 . G . 31078 1 65 . G . 31078 1 66 . G . 31078 1 67 . U . 31078 1 68 . U . 31078 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 31078 1 . A 2 2 31078 1 . G 3 3 31078 1 . A 4 4 31078 1 . A 5 5 31078 1 . U 6 6 31078 1 . C 7 7 31078 1 . C 8 8 31078 1 . A 9 9 31078 1 . G 10 10 31078 1 . C 11 11 31078 1 . U 12 12 31078 1 . C 13 13 31078 1 . U 14 14 31078 1 . G 15 15 31078 1 . G 16 16 31078 1 . A 17 17 31078 1 . A 18 18 31078 1 . G 19 19 31078 1 . C 20 20 31078 1 . G 21 21 31078 1 . U 22 22 31078 1 . U 23 23 31078 1 . U 24 24 31078 1 . A 25 25 31078 1 . U 26 26 31078 1 . A 27 27 31078 1 . U 28 28 31078 1 . A 29 29 31078 1 . A 30 30 31078 1 . C 31 31 31078 1 . A 32 32 31078 1 . U 33 33 31078 1 . G 34 34 31078 1 . A 35 35 31078 1 . A 36 36 31078 1 . A 37 37 31078 1 . U 38 38 31078 1 . A 39 39 31078 1 . U 40 40 31078 1 . A 41 41 31078 1 . U 42 42 31078 1 . A 43 43 31078 1 . U 44 44 31078 1 . A 45 45 31078 1 . C 46 46 31078 1 . G 47 47 31078 1 . C 48 48 31078 1 . A 49 49 31078 1 . U 50 50 31078 1 . U 51 51 31078 1 . C 52 52 31078 1 . C 53 53 31078 1 . G 54 54 31078 1 . A 55 55 31078 1 . U 56 56 31078 1 . C 57 57 31078 1 . A 58 58 31078 1 . A 59 59 31078 1 . A 60 60 31078 1 . G 61 61 31078 1 . C 62 62 31078 1 . U 63 63 31078 1 . G 64 64 31078 1 . G 65 65 31078 1 . G 66 66 31078 1 . U 67 67 31078 1 . U 68 68 31078 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 31078 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 7227 organism . 'Drosophila melanogaster' 'fruit fly' . . Eukaryota Metazoa Drosophila melanogaster . . . . . . . . . . . . . 31078 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 31078 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 31078 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 31078 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM TCEI_III, 10 mM sodium phosphate, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TCEI_III 'natural abundance' . . 1 $entity_1 . . 1 . . mM . . . . 31078 1 2 'sodium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 31078 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 31078 _Sample.ID 2 _Sample.Name . _Sample.Type 'filamentous virus' _Sample.Sub_type . _Sample.Details '1 mM [U-100% 15N] TCEI_III, 10 mM sodium phosphate, 18 mg/mL nat Pf1 phage, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 TCEI_III '[U-100% 15N]' . . 1 $entity_1 . . 1 . . mM . . . . 31078 2 2 'sodium phosphate' 'natural abundance' . . . . . . 10 . . mM . . . . 31078 2 3 'Pf1 phage' nat . . . . . . 18 . . mg/mL . . . . 31078 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 31078 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 31078 1 pH 6.8 . pH 31078 1 pressure 1 . atm 31078 1 temperature 278 . K 31078 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 31078 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 10 . mM 31078 2 pH 6.8 . pH 31078 2 pressure 1 . atm 31078 2 temperature 278 . K 31078 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 31078 _Software.ID 1 _Software.Type . _Software.Name NMRDraw _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 31078 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 31078 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 31078 _Software.ID 2 _Software.Type . _Software.Name NMRViewJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Johnson . . 31078 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 31078 2 'peak picking' . 31078 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 31078 _Software.ID 3 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 31078 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 31078 3 'structure calculation' . 31078 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 31078 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent _NMR_spectrometer.Model 'Direct Drive' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 31078 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Agilent 'Direct Drive' . 800 . . . 31078 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 31078 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 31078 1 2 '1H 15N ARTSY' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 31078 1 3 '2D 1H-15N HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 31078 1 4 '2D 1H-15N HSQC' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 31078 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 31078 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 31078 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 31078 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 31078 1 2 '1H 15N ARTSY' . . . 31078 1 3 '2D 1H-15N HSQC' . . . 31078 1 4 '2D 1H-15N HSQC' . . . 31078 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 6 6 U H3 H 1 11.9885 0.0000 . 1 . . . . A 6 U H3 . 31078 1 2 . 1 . 1 12 12 U H3 H 1 13.8048 0.0000 . 1 . . . . A 12 U H3 . 31078 1 3 . 1 . 1 21 21 G H1 H 1 13.0689 0.0000 . 1 . . . . A 21 G H1 . 31078 1 4 . 1 . 1 22 22 U H3 H 1 14.3119 0.0000 . 1 . . . . A 22 U H3 . 31078 1 5 . 1 . 1 23 23 U H3 H 1 10.1892 0.0000 . 1 . . . . A 23 U H3 . 31078 1 6 . 1 . 1 24 24 U H3 H 1 13.9141 0.0000 . 1 . . . . A 24 U H3 . 31078 1 7 . 1 . 1 26 26 U H3 H 1 13.2657 0.0000 . 1 . . . . A 26 U H3 . 31078 1 8 . 1 . 1 28 28 U H3 H 1 13.2700 0.0000 . 1 . . . . A 28 U H3 . 31078 1 9 . 1 . 1 40 40 U H3 H 1 13.2468 0.0000 . 1 . . . . A 40 U H3 . 31078 1 10 . 1 . 1 42 42 U H3 H 1 13.0157 0.0000 . 1 . . . . A 42 U H3 . 31078 1 11 . 1 . 1 44 44 U H3 H 1 10.5103 0.0000 . 1 . . . . A 44 U H3 . 31078 1 12 . 1 . 1 61 61 G H1 H 1 12.2883 0.0000 . 1 . . . . A 61 G H1 . 31078 1 13 . 1 . 1 63 63 U H3 H 1 13.5559 0.0000 . 1 . . . . A 63 U H3 . 31078 1 14 . 1 . 1 64 64 G H1 H 1 12.1380 0.0000 . 1 . . . . A 64 G H1 . 31078 1 15 . 1 . 1 65 65 G H1 H 1 12.7200 0.0000 . 1 . . . . A 65 G H1 . 31078 1 16 . 1 . 1 66 66 G H1 H 1 11.6516 0.0000 . 1 . . . . A 66 G H1 . 31078 1 17 . 1 . 1 67 67 U H3 H 1 14.5060 0.0000 . 1 . . . . A 67 U H3 . 31078 1 stop_ save_