data_34529 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34529 _Entry.Title ; G-quadruplex with a G-A bulge ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-07-13 _Entry.Accession_date 2020-07-13 _Entry.Last_release_date 2020-08-06 _Entry.Original_release_date 2020-08-06 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 M. 'Lenarcic Zivkovic' M. . . . 34529 2 J. Plavec J. . . . 34529 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 34529 'G-quadruplex Structure Bulge Osteoporosis' . 34529 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34529 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 185 34529 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2022-03-25 2020-07-13 update BMRB 'update entry citation' 34529 1 . . 2021-05-21 2020-07-13 original author 'original release' 34529 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 6ZRM 'BMRB Entry Tracking System' 34529 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34529 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 33096904 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Structure of a DNA G-Quadruplex Related to Osteoporosis with a G-A Bulge Forming a Pseudo-loop ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Molecules _Citation.Journal_name_full 'Molecules (Basel, Switzerland)' _Citation.Journal_volume 25 _Citation.Journal_issue 20 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1420-3049 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 4867 _Citation.Page_last 4867 _Citation.Year 2020 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 M. 'Lenarcic Zivkovic' M. . . . 34529 1 2 J. Rozman J. . . . 34529 1 3 J. Plavec J. . . . 34529 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34529 _Assembly.ID 1 _Assembly.Name "DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34529 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34529 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; TGGGAGGGAGCGGGAGTGGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 20 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6401.113 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DT . 34529 1 2 . DG . 34529 1 3 . DG . 34529 1 4 . DG . 34529 1 5 . DA . 34529 1 6 . DG . 34529 1 7 . DG . 34529 1 8 . DG . 34529 1 9 . DA . 34529 1 10 . DG . 34529 1 11 . DC . 34529 1 12 . DG . 34529 1 13 . DG . 34529 1 14 . DG . 34529 1 15 . DA . 34529 1 16 . DG . 34529 1 17 . DT . 34529 1 18 . DG . 34529 1 19 . DG . 34529 1 20 . DG . 34529 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DT 1 1 34529 1 . DG 2 2 34529 1 . DG 3 3 34529 1 . DG 4 4 34529 1 . DA 5 5 34529 1 . DG 6 6 34529 1 . DG 7 7 34529 1 . DG 8 8 34529 1 . DA 9 9 34529 1 . DG 10 10 34529 1 . DC 11 11 34529 1 . DG 12 12 34529 1 . DG 13 13 34529 1 . DG 14 14 34529 1 . DA 15 15 34529 1 . DG 16 16 34529 1 . DT 17 17 34529 1 . DG 18 18 34529 1 . DG 19 19 34529 1 . DG 20 20 34529 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34529 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 34529 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34529 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34529 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34529 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details "0.6 mM / DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3'), 90% H2O/10% D2O" _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3')" 'natural abundance' 1 $assembly 1 $entity_1 . . 0.6 . . mM . . . . 34529 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34529 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details "0.6 mM / DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3'), 100% D2O" _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "DNA (5'-D(*TP*GP*GP*GP*AP*GP*GP*GP*AP*GP*CP*GP*GP*GP*AP*GP*TP*GP*GP*G)-3')" 'natural abundance' 1 $assembly 1 $entity_1 . . 0.6 . . mM . . . . 34529 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34529 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 70 . mM 34529 1 pH 7 . pH 34529 1 pressure 1 . atm 34529 1 temperature 298 . K 34529 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 34529 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 70 . mM 34529 2 pH 7 . pH 34529 2 pressure 1 . atm 34529 2 temperature 298 . K 34529 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34529 _Software.ID 1 _Software.Type . _Software.Name Sparky _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 34529 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34529 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34529 _Software.ID 2 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34529 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34529 2 'structure calculation' . 34529 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34529 _Software.ID 3 _Software.Type . _Software.Name VNMR _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Varian . . 34529 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 34529 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34529 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent _NMR_spectrometer.Model VNMRS _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 34529 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Agilent _NMR_spectrometer.Model VNMRS _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34529 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Agilent VNMRS . 600 . . . 34529 1 2 NMR_spectrometer_2 Agilent VNMRS . 800 . . . 34529 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34529 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34529 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34529 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34529 1 4 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34529 1 5 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34529 1 6 '2D DQF-COSY' no . . . . . . . . . . . . 2 $sample_2 anisotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34529 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34529 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.000 internal direct 1.0 . . . . . 34529 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34529 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34529 1 2 '2D 1H-1H NOESY' . . . 34529 1 3 '2D 1H-1H NOESY' . . . 34529 1 4 '2D 1H-1H NOESY' . . . 34529 1 5 '2D 1H-1H TOCSY' . . . 34529 1 6 '2D DQF-COSY' . . . 34529 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DT H1' H 1 5.599 0.005 31 . . . . . A 1 DT H1' . 34529 1 2 . 1 . 1 1 1 DT H2' H 1 1.861 0.006 29 . . . . . A 1 DT H2' . 34529 1 3 . 1 . 1 1 1 DT H2'' H 1 2.180 0.006 33 . . . . . A 1 DT H2'' . 34529 1 4 . 1 . 1 1 1 DT H3' H 1 4.529 0.004 17 . . . . . A 1 DT H3' . 34529 1 5 . 1 . 1 1 1 DT H4' H 1 3.827 0.004 26 . . . . . A 1 DT H4' . 34529 1 6 . 1 . 1 1 1 DT H5' H 1 3.470 0.006 17 . . . . . A 1 DT H5' . 34529 1 7 . 1 . 1 1 1 DT H5'' H 1 3.468 0.005 17 . . . . . A 1 DT H5'' . 34529 1 8 . 1 . 1 1 1 DT H6 H 1 7.163 0.004 36 . . . . . A 1 DT H6 . 34529 1 9 . 1 . 1 1 1 DT H71 H 1 1.246 0.004 17 . . . . . A 1 DT H71 . 34529 1 10 . 1 . 1 1 1 DT H72 H 1 1.246 0.004 17 . . . . . A 1 DT H72 . 34529 1 11 . 1 . 1 1 1 DT H73 H 1 1.246 0.004 17 . . . . . A 1 DT H73 . 34529 1 12 . 1 . 1 2 2 DG H1 H 1 11.708 0.004 8 . . . . . A 2 DG H1 . 34529 1 13 . 1 . 1 2 2 DG H1' H 1 5.996 0.004 32 . . . . . A 2 DG H1' . 34529 1 14 . 1 . 1 2 2 DG H2' H 1 2.693 0.005 31 . . . . . A 2 DG H2' . 34529 1 15 . 1 . 1 2 2 DG H2'' H 1 2.937 0.004 28 . . . . . A 2 DG H2'' . 34529 1 16 . 1 . 1 2 2 DG H3' H 1 4.903 0.005 31 . . . . . A 2 DG H3' . 34529 1 17 . 1 . 1 2 2 DG H4' H 1 4.313 0.004 28 . . . . . A 2 DG H4' . 34529 1 18 . 1 . 1 2 2 DG H5' H 1 3.957 0.005 20 . . . . . A 2 DG H5' . 34529 1 19 . 1 . 1 2 2 DG H5'' H 1 3.920 0.005 20 . . . . . A 2 DG H5'' . 34529 1 20 . 1 . 1 2 2 DG H8 H 1 7.948 0.005 58 . . . . . A 2 DG H8 . 34529 1 21 . 1 . 1 3 3 DG H1 H 1 11.108 0.005 20 . . . . . A 3 DG H1 . 34529 1 22 . 1 . 1 3 3 DG H1' H 1 6.055 0.006 31 . . . . . A 3 DG H1' . 34529 1 23 . 1 . 1 3 3 DG H2' H 1 2.580 0.006 31 . . . . . A 3 DG H2' . 34529 1 24 . 1 . 1 3 3 DG H2'' H 1 2.846 0.005 29 . . . . . A 3 DG H2'' . 34529 1 25 . 1 . 1 3 3 DG H3' H 1 4.904 0.005 29 . . . . . A 3 DG H3' . 34529 1 26 . 1 . 1 3 3 DG H4' H 1 4.437 0.005 26 . . . . . A 3 DG H4' . 34529 1 27 . 1 . 1 3 3 DG H5' H 1 4.198 0.004 13 . . . . . A 3 DG H5' . 34529 1 28 . 1 . 1 3 3 DG H5'' H 1 4.196 0.004 11 . . . . . A 3 DG H5'' . 34529 1 29 . 1 . 1 3 3 DG H8 H 1 7.626 0.005 51 . . . . . A 3 DG H8 . 34529 1 30 . 1 . 1 3 3 DG H21 H 1 6.840 0.004 4 . . . . . A 3 DG H21 . 34529 1 31 . 1 . 1 3 3 DG H22 H 1 9.239 0.003 2 . . . . . A 3 DG H22 . 34529 1 32 . 1 . 1 4 4 DG H1 H 1 10.766 0.004 16 . . . . . A 4 DG H1 . 34529 1 33 . 1 . 1 4 4 DG H1' H 1 6.368 0.005 25 . . . . . A 4 DG H1' . 34529 1 34 . 1 . 1 4 4 DG H2' H 1 2.600 0.006 22 . . . . . A 4 DG H2' . 34529 1 35 . 1 . 1 4 4 DG H2'' H 1 2.502 0.005 21 . . . . . A 4 DG H2'' . 34529 1 36 . 1 . 1 4 4 DG H3' H 1 5.011 0.004 26 . . . . . A 4 DG H3' . 34529 1 37 . 1 . 1 4 4 DG H4' H 1 4.570 0.005 10 . . . . . A 4 DG H4' . 34529 1 38 . 1 . 1 4 4 DG H5' H 1 4.321 0.006 22 . . . . . A 4 DG H5' . 34529 1 39 . 1 . 1 4 4 DG H5'' H 1 4.210 0.005 24 . . . . . A 4 DG H5'' . 34529 1 40 . 1 . 1 4 4 DG H8 H 1 7.709 0.006 45 . . . . . A 4 DG H8 . 34529 1 41 . 1 . 1 5 5 DA H1' H 1 6.561 0.005 25 . . . . . A 5 DA H1' . 34529 1 42 . 1 . 1 5 5 DA H2 H 1 8.183 0.004 3 . . . . . A 5 DA H2 . 34529 1 43 . 1 . 1 5 5 DA H2' H 1 2.793 0.006 16 . . . . . A 5 DA H2' . 34529 1 44 . 1 . 1 5 5 DA H2'' H 1 2.793 0.005 14 . . . . . A 5 DA H2'' . 34529 1 45 . 1 . 1 5 5 DA H3' H 1 5.131 0.005 29 . . . . . A 5 DA H3' . 34529 1 46 . 1 . 1 5 5 DA H4' H 1 4.580 0.004 6 . . . . . A 5 DA H4' . 34529 1 47 . 1 . 1 5 5 DA H5' H 1 4.208 0.005 8 . . . . . A 5 DA H5' . 34529 1 48 . 1 . 1 5 5 DA H5'' H 1 4.208 0.007 8 . . . . . A 5 DA H5'' . 34529 1 49 . 1 . 1 5 5 DA H8 H 1 8.413 0.005 25 . . . . . A 5 DA H8 . 34529 1 50 . 1 . 1 6 6 DG H1 H 1 11.786 0.006 7 . . . . . A 6 DG H1 . 34529 1 51 . 1 . 1 6 6 DG H1' H 1 6.094 0.005 28 . . . . . A 6 DG H1' . 34529 1 52 . 1 . 1 6 6 DG H2' H 1 2.429 0.005 27 . . . . . A 6 DG H2' . 34529 1 53 . 1 . 1 6 6 DG H2'' H 1 2.934 0.004 20 . . . . . A 6 DG H2'' . 34529 1 54 . 1 . 1 6 6 DG H3' H 1 5.098 0.004 36 . . . . . A 6 DG H3' . 34529 1 55 . 1 . 1 6 6 DG H4' H 1 4.376 0.004 19 . . . . . A 6 DG H4' . 34529 1 56 . 1 . 1 6 6 DG H5' H 1 4.277 0.004 12 . . . . . A 6 DG H5' . 34529 1 57 . 1 . 1 6 6 DG H5'' H 1 4.165 0.004 10 . . . . . A 6 DG H5'' . 34529 1 58 . 1 . 1 6 6 DG H8 H 1 8.000 0.006 29 . . . . . A 6 DG H8 . 34529 1 59 . 1 . 1 7 7 DG H1 H 1 11.287 0.005 16 . . . . . A 7 DG H1 . 34529 1 60 . 1 . 1 7 7 DG H1' H 1 6.256 0.006 28 . . . . . A 7 DG H1' . 34529 1 61 . 1 . 1 7 7 DG H2' H 1 2.630 0.006 23 . . . . . A 7 DG H2' . 34529 1 62 . 1 . 1 7 7 DG H2'' H 1 2.889 0.005 23 . . . . . A 7 DG H2'' . 34529 1 63 . 1 . 1 7 7 DG H3' H 1 5.021 0.005 25 . . . . . A 7 DG H3' . 34529 1 64 . 1 . 1 7 7 DG H4' H 1 4.513 0.004 6 . . . . . A 7 DG H4' . 34529 1 65 . 1 . 1 7 7 DG H5'' H 1 4.192 0.004 8 . . . . . A 7 DG H5'' . 34529 1 66 . 1 . 1 7 7 DG H8 H 1 7.944 0.004 48 . . . . . A 7 DG H8 . 34529 1 67 . 1 . 1 7 7 DG H21 H 1 6.518 0.004 2 . . . . . A 7 DG H21 . 34529 1 68 . 1 . 1 7 7 DG H22 H 1 9.133 0.003 2 . . . . . A 7 DG H22 . 34529 1 69 . 1 . 1 8 8 DG H1 H 1 11.297 0.005 20 . . . . . A 8 DG H1 . 34529 1 70 . 1 . 1 8 8 DG H1' H 1 6.299 0.004 19 . . . . . A 8 DG H1' . 34529 1 71 . 1 . 1 8 8 DG H2' H 1 2.543 0.005 20 . . . . . A 8 DG H2' . 34529 1 72 . 1 . 1 8 8 DG H2'' H 1 2.665 0.005 16 . . . . . A 8 DG H2'' . 34529 1 73 . 1 . 1 8 8 DG H3' H 1 4.822 0.004 24 . . . . . A 8 DG H3' . 34529 1 74 . 1 . 1 8 8 DG H4' H 1 4.187 0.005 6 . . . . . A 8 DG H4' . 34529 1 75 . 1 . 1 8 8 DG H5' H 1 4.349 0.006 9 . . . . . A 8 DG H5' . 34529 1 76 . 1 . 1 8 8 DG H5'' H 1 4.275 0.005 8 . . . . . A 8 DG H5'' . 34529 1 77 . 1 . 1 8 8 DG H8 H 1 7.752 0.005 39 . . . . . A 8 DG H8 . 34529 1 78 . 1 . 1 8 8 DG H21 H 1 6.952 0.003 2 . . . . . A 8 DG H21 . 34529 1 79 . 1 . 1 8 8 DG H22 H 1 8.889 0.003 2 . . . . . A 8 DG H22 . 34529 1 80 . 1 . 1 9 9 DA H1' H 1 5.981 0.004 16 . . . . . A 9 DA H1' . 34529 1 81 . 1 . 1 9 9 DA H2 H 1 7.962 0.005 3 . . . . . A 9 DA H2 . 34529 1 82 . 1 . 1 9 9 DA H2' H 1 2.005 0.005 19 . . . . . A 9 DA H2' . 34529 1 83 . 1 . 1 9 9 DA H2'' H 1 2.582 0.006 13 . . . . . A 9 DA H2'' . 34529 1 84 . 1 . 1 9 9 DA H3' H 1 4.669 0.006 7 . . . . . A 9 DA H3' . 34529 1 85 . 1 . 1 9 9 DA H4' H 1 4.079 0.004 14 . . . . . A 9 DA H4' . 34529 1 86 . 1 . 1 9 9 DA H5' H 1 3.525 0.005 17 . . . . . A 9 DA H5' . 34529 1 87 . 1 . 1 9 9 DA H5'' H 1 2.865 0.004 14 . . . . . A 9 DA H5'' . 34529 1 88 . 1 . 1 9 9 DA H8 H 1 7.739 0.004 26 . . . . . A 9 DA H8 . 34529 1 89 . 1 . 1 10 10 DG H1' H 1 6.147 0.005 28 . . . . . A 10 DG H1' . 34529 1 90 . 1 . 1 10 10 DG H2' H 1 2.651 0.006 18 . . . . . A 10 DG H2' . 34529 1 91 . 1 . 1 10 10 DG H2'' H 1 2.801 0.007 18 . . . . . A 10 DG H2'' . 34529 1 92 . 1 . 1 10 10 DG H3' H 1 5.096 0.004 14 . . . . . A 10 DG H3' . 34529 1 93 . 1 . 1 10 10 DG H4' H 1 4.329 0.004 10 . . . . . A 10 DG H4' . 34529 1 94 . 1 . 1 10 10 DG H5'' H 1 4.150 0.006 18 . . . . . A 10 DG H5'' . 34529 1 95 . 1 . 1 10 10 DG H8 H 1 7.971 0.006 14 . . . . . A 10 DG H8 . 34529 1 96 . 1 . 1 11 11 DC H1' H 1 6.081 0.005 19 . . . . . A 11 DC H1' . 34529 1 97 . 1 . 1 11 11 DC H2' H 1 2.151 0.006 18 . . . . . A 11 DC H2' . 34529 1 98 . 1 . 1 11 11 DC H2'' H 1 2.487 0.007 15 . . . . . A 11 DC H2'' . 34529 1 99 . 1 . 1 11 11 DC H4' H 1 4.283 0.005 8 . . . . . A 11 DC H4' . 34529 1 100 . 1 . 1 11 11 DC H5 H 1 6.041 0.004 4 . . . . . A 11 DC H5 . 34529 1 101 . 1 . 1 11 11 DC H6 H 1 7.969 0.005 19 . . . . . A 11 DC H6 . 34529 1 102 . 1 . 1 12 12 DG H1 H 1 11.912 0.004 11 . . . . . A 12 DG H1 . 34529 1 103 . 1 . 1 12 12 DG H1' H 1 5.849 0.005 21 . . . . . A 12 DG H1' . 34529 1 104 . 1 . 1 12 12 DG H2' H 1 2.339 0.007 16 . . . . . A 12 DG H2' . 34529 1 105 . 1 . 1 12 12 DG H2'' H 1 2.529 0.006 13 . . . . . A 12 DG H2'' . 34529 1 106 . 1 . 1 12 12 DG H3' H 1 4.656 0.004 4 . . . . . A 12 DG H3' . 34529 1 107 . 1 . 1 12 12 DG H4' H 1 4.193 0.004 16 . . . . . A 12 DG H4' . 34529 1 108 . 1 . 1 12 12 DG H5' H 1 3.530 0.004 10 . . . . . A 12 DG H5' . 34529 1 109 . 1 . 1 12 12 DG H5'' H 1 3.256 0.004 12 . . . . . A 12 DG H5'' . 34529 1 110 . 1 . 1 12 12 DG H8 H 1 7.766 0.005 23 . . . . . A 12 DG H8 . 34529 1 111 . 1 . 1 13 13 DG H1 H 1 11.224 0.005 24 . . . . . A 13 DG H1 . 34529 1 112 . 1 . 1 13 13 DG H1' H 1 5.738 0.004 31 . . . . . A 13 DG H1' . 34529 1 113 . 1 . 1 13 13 DG H2' H 1 1.455 0.004 30 . . . . . A 13 DG H2' . 34529 1 114 . 1 . 1 13 13 DG H2'' H 1 2.418 0.004 31 . . . . . A 13 DG H2'' . 34529 1 115 . 1 . 1 13 13 DG H3' H 1 3.881 0.005 30 . . . . . A 13 DG H3' . 34529 1 116 . 1 . 1 13 13 DG H4' H 1 4.277 0.004 25 . . . . . A 13 DG H4' . 34529 1 117 . 1 . 1 13 13 DG H5' H 1 4.060 0.007 20 . . . . . A 13 DG H5' . 34529 1 118 . 1 . 1 13 13 DG H5'' H 1 3.734 0.006 20 . . . . . A 13 DG H5'' . 34529 1 119 . 1 . 1 13 13 DG H8 H 1 7.660 0.007 37 . . . . . A 13 DG H8 . 34529 1 120 . 1 . 1 13 13 DG H21 H 1 6.341 0.004 2 . . . . . A 13 DG H21 . 34529 1 121 . 1 . 1 13 13 DG H22 H 1 9.087 0.003 2 . . . . . A 13 DG H22 . 34529 1 122 . 1 . 1 14 14 DG H1' H 1 6.008 0.006 12 . . . . . A 14 DG H1' . 34529 1 123 . 1 . 1 14 14 DG H2' H 1 2.867 0.007 24 . . . . . A 14 DG H2' . 34529 1 124 . 1 . 1 14 14 DG H2'' H 1 2.518 0.005 16 . . . . . A 14 DG H2'' . 34529 1 125 . 1 . 1 14 14 DG H3' H 1 4.733 0.006 12 . . . . . A 14 DG H3' . 34529 1 126 . 1 . 1 14 14 DG H4' H 1 4.035 0.005 32 . . . . . A 14 DG H4' . 34529 1 127 . 1 . 1 14 14 DG H5' H 1 3.437 0.004 24 . . . . . A 14 DG H5' . 34529 1 128 . 1 . 1 14 14 DG H5'' H 1 3.937 0.005 22 . . . . . A 14 DG H5'' . 34529 1 129 . 1 . 1 14 14 DG H8 H 1 7.519 0.004 26 . . . . . A 14 DG H8 . 34529 1 130 . 1 . 1 15 15 DA H1' H 1 5.595 0.005 31 . . . . . A 15 DA H1' . 34529 1 131 . 1 . 1 15 15 DA H2 H 1 7.190 0.005 13 . . . . . A 15 DA H2 . 34529 1 132 . 1 . 1 15 15 DA H2' H 1 1.525 0.004 24 . . . . . A 15 DA H2' . 34529 1 133 . 1 . 1 15 15 DA H2'' H 1 2.223 0.006 23 . . . . . A 15 DA H2'' . 34529 1 134 . 1 . 1 15 15 DA H3' H 1 4.428 0.005 24 . . . . . A 15 DA H3' . 34529 1 135 . 1 . 1 15 15 DA H4' H 1 3.616 0.005 40 . . . . . A 15 DA H4' . 34529 1 136 . 1 . 1 15 15 DA H5' H 1 2.886 0.004 29 . . . . . A 15 DA H5' . 34529 1 137 . 1 . 1 15 15 DA H5'' H 1 2.766 0.005 26 . . . . . A 15 DA H5'' . 34529 1 138 . 1 . 1 15 15 DA H8 H 1 7.385 0.004 33 . . . . . A 15 DA H8 . 34529 1 139 . 1 . 1 16 16 DG H1 H 1 10.594 0.004 30 . . . . . A 16 DG H1 . 34529 1 140 . 1 . 1 16 16 DG H1' H 1 6.169 0.004 43 . . . . . A 16 DG H1' . 34529 1 141 . 1 . 1 16 16 DG H2' H 1 3.698 0.005 25 . . . . . A 16 DG H2' . 34529 1 142 . 1 . 1 16 16 DG H2'' H 1 2.726 0.006 19 . . . . . A 16 DG H2'' . 34529 1 143 . 1 . 1 16 16 DG H3' H 1 4.971 0.005 24 . . . . . A 16 DG H3' . 34529 1 144 . 1 . 1 16 16 DG H4' H 1 4.241 0.005 15 . . . . . A 16 DG H4' . 34529 1 145 . 1 . 1 16 16 DG H5'' H 1 3.991 0.001 5 . . . . . A 16 DG H5'' . 34529 1 146 . 1 . 1 16 16 DG H8 H 1 7.683 0.006 44 . . . . . A 16 DG H8 . 34529 1 147 . 1 . 1 17 17 DT H1' H 1 6.327 0.004 28 . . . . . A 17 DT H1' . 34529 1 148 . 1 . 1 17 17 DT H2' H 1 2.367 0.005 25 . . . . . A 17 DT H2' . 34529 1 149 . 1 . 1 17 17 DT H2'' H 1 2.469 0.006 16 . . . . . A 17 DT H2'' . 34529 1 150 . 1 . 1 17 17 DT H3' H 1 4.891 0.005 33 . . . . . A 17 DT H3' . 34529 1 151 . 1 . 1 17 17 DT H4' H 1 4.393 0.005 28 . . . . . A 17 DT H4' . 34529 1 152 . 1 . 1 17 17 DT H5' H 1 4.170 0.006 16 . . . . . A 17 DT H5' . 34529 1 153 . 1 . 1 17 17 DT H5'' H 1 4.096 0.005 20 . . . . . A 17 DT H5'' . 34529 1 154 . 1 . 1 17 17 DT H6 H 1 7.691 0.004 32 . . . . . A 17 DT H6 . 34529 1 155 . 1 . 1 17 17 DT H71 H 1 1.825 0.004 5 . . . . . A 17 DT H71 . 34529 1 156 . 1 . 1 17 17 DT H72 H 1 1.825 0.004 5 . . . . . A 17 DT H72 . 34529 1 157 . 1 . 1 17 17 DT H73 H 1 1.825 0.004 5 . . . . . A 17 DT H73 . 34529 1 158 . 1 . 1 18 18 DG H1 H 1 11.604 0.004 22 . . . . . A 18 DG H1 . 34529 1 159 . 1 . 1 18 18 DG H1' H 1 5.971 0.005 33 . . . . . A 18 DG H1' . 34529 1 160 . 1 . 1 18 18 DG H2' H 1 2.466 0.007 29 . . . . . A 18 DG H2' . 34529 1 161 . 1 . 1 18 18 DG H2'' H 1 2.791 0.004 26 . . . . . A 18 DG H2'' . 34529 1 162 . 1 . 1 18 18 DG H3' H 1 4.960 0.007 36 . . . . . A 18 DG H3' . 34529 1 163 . 1 . 1 18 18 DG H4' H 1 4.287 0.004 17 . . . . . A 18 DG H4' . 34529 1 164 . 1 . 1 18 18 DG H5' H 1 4.101 0.004 10 . . . . . A 18 DG H5' . 34529 1 165 . 1 . 1 18 18 DG H5'' H 1 4.099 0.006 16 . . . . . A 18 DG H5'' . 34529 1 166 . 1 . 1 18 18 DG H8 H 1 7.983 0.005 41 . . . . . A 18 DG H8 . 34529 1 167 . 1 . 1 19 19 DG H1 H 1 11.314 0.005 26 . . . . . A 19 DG H1 . 34529 1 168 . 1 . 1 19 19 DG H1' H 1 5.979 0.006 31 . . . . . A 19 DG H1' . 34529 1 169 . 1 . 1 19 19 DG H2' H 1 2.534 0.006 30 . . . . . A 19 DG H2' . 34529 1 170 . 1 . 1 19 19 DG H2'' H 1 2.658 0.005 27 . . . . . A 19 DG H2'' . 34529 1 171 . 1 . 1 19 19 DG H3' H 1 4.928 0.005 32 . . . . . A 19 DG H3' . 34529 1 172 . 1 . 1 19 19 DG H4' H 1 4.410 0.005 23 . . . . . A 19 DG H4' . 34529 1 173 . 1 . 1 19 19 DG H5' H 1 4.108 0.005 14 . . . . . A 19 DG H5' . 34529 1 174 . 1 . 1 19 19 DG H5'' H 1 4.107 0.005 22 . . . . . A 19 DG H5'' . 34529 1 175 . 1 . 1 19 19 DG H8 H 1 7.782 0.006 53 . . . . . A 19 DG H8 . 34529 1 176 . 1 . 1 19 19 DG H21 H 1 5.865 0.004 2 . . . . . A 19 DG H21 . 34529 1 177 . 1 . 1 19 19 DG H22 H 1 9.273 0.004 2 . . . . . A 19 DG H22 . 34529 1 178 . 1 . 1 20 20 DG H1 H 1 10.678 0.005 18 . . . . . A 20 DG H1 . 34529 1 179 . 1 . 1 20 20 DG H1' H 1 6.241 0.004 22 . . . . . A 20 DG H1' . 34529 1 180 . 1 . 1 20 20 DG H2' H 1 2.551 0.005 14 . . . . . A 20 DG H2' . 34529 1 181 . 1 . 1 20 20 DG H2'' H 1 2.426 0.004 16 . . . . . A 20 DG H2'' . 34529 1 182 . 1 . 1 20 20 DG H3' H 1 4.626 0.007 4 . . . . . A 20 DG H3' . 34529 1 183 . 1 . 1 20 20 DG H4' H 1 4.278 0.004 8 . . . . . A 20 DG H4' . 34529 1 184 . 1 . 1 20 20 DG H5'' H 1 4.158 0.004 4 . . . . . A 20 DG H5'' . 34529 1 185 . 1 . 1 20 20 DG H8 H 1 7.701 0.009 41 . . . . . A 20 DG H8 . 34529 1 stop_ save_