data_34631 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34631 _Entry.Title ; G-quadruplex structure of the C. elegans telomeric repeat: A two tetrads basket type conformation stabilised by a Hoogsteen C-T base-pair ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-06-04 _Entry.Accession_date 2021-06-04 _Entry.Last_release_date 2021-06-11 _Entry.Original_release_date 2021-06-11 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 J. Marquevielle J. . . . 34631 2 A. 'De Rache' A. . . . 34631 3 S. Amrane S. . . . 34631 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 'C. elegans telomere' . 34631 DNA . 34631 G-quadruplex . 34631 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34631 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 69 34631 '1H chemical shifts' 184 34631 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2024-03-14 2021-06-04 update BMRB 'update entry citation' 34631 1 . . 2022-06-14 2021-06-04 original author 'original release' 34631 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7OQT 'BMRB Entry Tracking System' 34631 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34631 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 35736226 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; G-quadruplex structure of the C. elegans telomeric repeat: a two tetrads basket type conformation stabilized by a non-canonical C-T base-pair ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full 'Nucleic acids research' _Citation.Journal_volume 50 _Citation.Journal_issue 12 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1362-4962 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 7134 _Citation.Page_last 7146 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 J. Marquevielle J. . . . 34631 1 2 A. 'De Rache' A. . . . 34631 1 3 B. Vialet B. . . . 34631 1 4 E. Morvan E. . . . 34631 1 5 J. Mergny J. L. . . 34631 1 6 S. Amrane S. . . . 34631 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34631 _Assembly.ID 1 _Assembly.Name "DNA (5'-D(*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*GP*CP*TP*TP*AP*GP*G)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34631 1 2 unit_2 2 $entity_K B A no . . . . . . 34631 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34631 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCTTAGGCTTAGGCTTAGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 20 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6221.012 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 34631 1 2 . DG . 34631 1 3 . DC . 34631 1 4 . DT . 34631 1 5 . DT . 34631 1 6 . DA . 34631 1 7 . DG . 34631 1 8 . DG . 34631 1 9 . DC . 34631 1 10 . DT . 34631 1 11 . DT . 34631 1 12 . DA . 34631 1 13 . DG . 34631 1 14 . DG . 34631 1 15 . DC . 34631 1 16 . DT . 34631 1 17 . DT . 34631 1 18 . DA . 34631 1 19 . DG . 34631 1 20 . DG . 34631 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 34631 1 . DG 2 2 34631 1 . DC 3 3 34631 1 . DT 4 4 34631 1 . DT 5 5 34631 1 . DA 6 6 34631 1 . DG 7 7 34631 1 . DG 8 8 34631 1 . DC 9 9 34631 1 . DT 10 10 34631 1 . DT 11 11 34631 1 . DA 12 12 34631 1 . DG 13 13 34631 1 . DG 14 14 34631 1 . DC 15 15 34631 1 . DT 16 16 34631 1 . DT 17 17 34631 1 . DA 18 18 34631 1 . DG 19 19 34631 1 . DG 20 20 34631 1 stop_ save_ save_entity_K _Entity.Sf_category entity _Entity.Sf_framecode entity_K _Entity.Entry_ID 34631 _Entity.ID 2 _Entity.BMRB_code K _Entity.Name entity_K _Entity.Type non-polymer _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID K _Entity.Nonpolymer_comp_label $chem_comp_K _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic . _Entity.Thiol_state . _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 39.098 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'POTASSIUM ION' BMRB 34631 2 stop_ loop_ _Entity_systematic_name.Name _Entity_systematic_name.Naming_system _Entity_systematic_name.Entry_ID _Entity_systematic_name.Entity_ID 'POTASSIUM ION' BMRB 34631 2 K 'Three letter code' 34631 2 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 K $chem_comp_K 34631 2 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34631 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 6239 organism . 'Caenorhabditis elegans' 'C. elegans' . . Eukaryota Metazoa Caenorhabditis elegans . . . . . . . . . . . . . 34631 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34631 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34631 1 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_K _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_K _Chem_comp.Entry_ID 34631 _Chem_comp.ID K _Chem_comp.Provenance PDB _Chem_comp.Name 'POTASSIUM ION' _Chem_comp.Type NON-POLYMER _Chem_comp.BMRB_code K _Chem_comp.PDB_code K _Chem_comp.Ambiguous_flag no _Chem_comp.Initial_date 2020-07-10 _Chem_comp.Modified_date 2020-07-10 _Chem_comp.Release_status REL _Chem_comp.Replaced_by . _Chem_comp.Replaces . _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code K _Chem_comp.Number_atoms_all 1 _Chem_comp.Number_atoms_nh 1 _Chem_comp.Atom_nomenclature_source . _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code InChI=1S/K/q+1 _Chem_comp.Mon_nstd_flag no _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms . _Chem_comp.Formal_charge 1 _Chem_comp.Paramagnetic . _Chem_comp.Aromatic no _Chem_comp.Formula K _Chem_comp.Formula_weight 39.098 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag no _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag no _Chem_comp.Model_coordinates_db_code . _Chem_comp.Processing_site RCSB _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . loop_ _Chem_comp_descriptor.Descriptor _Chem_comp_descriptor.Type _Chem_comp_descriptor.Program _Chem_comp_descriptor.Program_version _Chem_comp_descriptor.Entry_ID _Chem_comp_descriptor.Comp_ID InChI=1S/K/q+1 InChI InChI 1.03 34631 K NPYPAHLBTDXSSS-UHFFFAOYSA-N InChIKey InChI 1.03 34631 K [K+] SMILES ACDLabs 10.04 34631 K [K+] SMILES CACTVS 3.341 34631 K [K+] SMILES 'OpenEye OEToolkits' 1.5.0 34631 K [K+] SMILES_CANONICAL CACTVS 3.341 34631 K [K+] SMILES_CANONICAL 'OpenEye OEToolkits' 1.5.0 34631 K stop_ loop_ _Chem_comp_identifier.Identifier _Chem_comp_identifier.Type _Chem_comp_identifier.Program _Chem_comp_identifier.Program_version _Chem_comp_identifier.Entry_ID _Chem_comp_identifier.Comp_ID potassium 'SYSTEMATIC NAME' ACDLabs 10.04 34631 K 'potassium(+1) cation' 'SYSTEMATIC NAME' 'OpenEye OEToolkits' 1.5.0 34631 K stop_ loop_ _Chem_comp_atom.Atom_ID _Chem_comp_atom.BMRB_code _Chem_comp_atom.PDB_atom_ID _Chem_comp_atom.Alt_atom_ID _Chem_comp_atom.Auth_atom_ID _Chem_comp_atom.Type_symbol _Chem_comp_atom.Isotope_number _Chem_comp_atom.Chirality _Chem_comp_atom.Stereo_config _Chem_comp_atom.Charge _Chem_comp_atom.Partial_charge _Chem_comp_atom.Oxidation_number _Chem_comp_atom.Unpaired_electron_number _Chem_comp_atom.Align _Chem_comp_atom.Aromatic_flag _Chem_comp_atom.Leaving_atom_flag _Chem_comp_atom.Substruct_code _Chem_comp_atom.Ionizable _Chem_comp_atom.Drawing_2D_coord_x _Chem_comp_atom.Drawing_2D_coord_y _Chem_comp_atom.Model_Cartn_x _Chem_comp_atom.Model_Cartn_x_esd _Chem_comp_atom.Model_Cartn_y _Chem_comp_atom.Model_Cartn_y_esd _Chem_comp_atom.Model_Cartn_z _Chem_comp_atom.Model_Cartn_z_esd _Chem_comp_atom.Model_Cartn_x_ideal _Chem_comp_atom.Model_Cartn_y_ideal _Chem_comp_atom.Model_Cartn_z_ideal _Chem_comp_atom.PDBX_ordinal _Chem_comp_atom.Details _Chem_comp_atom.Entry_ID _Chem_comp_atom.Comp_ID K K K K . K . . N 1 . . . 1 N N . . . . 0.000 . 0.000 . 0.000 . 0.000 0.000 0.000 1 . 34631 K stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34631 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '2.4 mM 1H Asc20, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 Asc20 'natural abundance' . . 1 $entity_1 . . 2.4 . . mM . . . . 34631 1 2 KCl 'natural abundance' . . . . . . 70 . . mM . . . . 34631 1 3 KPi 'natural abundance' . . . . . . 20 . . mM . . . . 34631 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34631 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 90 . mM 34631 1 pH 6.9 . pH 34631 1 pressure 1 . atm 34631 1 temperature 288 . K 34631 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34631 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 34631 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 34631 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34631 _Software.ID 2 _Software.Type . _Software.Name Sparky _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 34631 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34631 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34631 _Software.ID 3 _Software.Type . _Software.Name ARIA _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID "Linge, O'Donoghue and Nilges" . . 34631 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 34631 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 34631 _Software.ID 4 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34631 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34631 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34631 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34631 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE III' . 700 . . . 34631 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34631 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34631 1 2 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34631 1 3 '2D 1H-13C HMBC' no . . . . . . . . . . . . 1 $sample_1 anisotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34631 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34631 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 water protons . . . . ppm 4.7 internal direct 1.0 . . . . . 34631 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34631 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34631 1 2 '2D 1H-13C HSQC' . . . 34631 1 3 '2D 1H-13C HMBC' . . . 34631 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1 H 1 11.707 0.005 . 1 . . . . A 1 DG H1 . 34631 1 2 . 1 . 1 1 1 DG H1' H 1 5.743 0.002 . 1 . . . . A 1 DG H1' . 34631 1 3 . 1 . 1 1 1 DG H2' H 1 2.666 0.012 . 1 . . . . A 1 DG H2' . 34631 1 4 . 1 . 1 1 1 DG H2'' H 1 2.861 0.014 . 1 . . . . A 1 DG H2'' . 34631 1 5 . 1 . 1 1 1 DG H3' H 1 4.800 0.005 . 1 . . . . A 1 DG H3' . 34631 1 6 . 1 . 1 1 1 DG H4' H 1 4.234 0.006 . 1 . . . . A 1 DG H4' . 34631 1 7 . 1 . 1 1 1 DG H5' H 1 4.102 0.002 . 1 . . . . A 1 DG H5' . 34631 1 8 . 1 . 1 1 1 DG H8 H 1 7.240 0.004 . 1 . . . . A 1 DG H8 . 34631 1 9 . 1 . 1 1 1 DG H21 H 1 10.390 0.004 . 1 . . . . A 1 DG H21 . 34631 1 10 . 1 . 1 1 1 DG H22 H 1 6.181 0.002 . 1 . . . . A 1 DG H22 . 34631 1 11 . 1 . 1 1 1 DG C1' C 13 87.172 0.000 . 1 . . . . A 1 DG C1' . 34631 1 12 . 1 . 1 1 1 DG C2' C 13 35.072 0.010 . 1 . . . . A 1 DG C2' . 34631 1 13 . 1 . 1 1 1 DG C8 C 13 138.658 0.000 . 1 . . . . A 1 DG C8 . 34631 1 14 . 1 . 1 2 2 DG H1 H 1 11.941 0.002 . 1 . . . . A 2 DG H1 . 34631 1 15 . 1 . 1 2 2 DG H1' H 1 5.925 0.004 . 1 . . . . A 2 DG H1' . 34631 1 16 . 1 . 1 2 2 DG H2' H 1 2.318 0.006 . 1 . . . . A 2 DG H2' . 34631 1 17 . 1 . 1 2 2 DG H2'' H 1 2.453 0.014 . 1 . . . . A 2 DG H2'' . 34631 1 18 . 1 . 1 2 2 DG H3' H 1 4.934 0.003 . 1 . . . . A 2 DG H3' . 34631 1 19 . 1 . 1 2 2 DG H4' H 1 4.236 0.004 . 1 . . . . A 2 DG H4' . 34631 1 20 . 1 . 1 2 2 DG H5' H 1 4.089 0.005 . 1 . . . . A 2 DG H5' . 34631 1 21 . 1 . 1 2 2 DG H5'' H 1 3.993 0.004 . 1 . . . . A 2 DG H5'' . 34631 1 22 . 1 . 1 2 2 DG H8 H 1 7.652 0.001 . 1 . . . . A 2 DG H8 . 34631 1 23 . 1 . 1 2 2 DG C1' C 13 80.704 0.000 . 1 . . . . A 2 DG C1' . 34631 1 24 . 1 . 1 2 2 DG C2' C 13 37.148 0.024 . 1 . . . . A 2 DG C2' . 34631 1 25 . 1 . 1 2 2 DG C8 C 13 134.964 0.000 . 1 . . . . A 2 DG C8 . 34631 1 26 . 1 . 1 3 3 DC H1' H 1 6.179 0.003 . 1 . . . . A 3 DC H1' . 34631 1 27 . 1 . 1 3 3 DC H2' H 1 2.206 0.015 . 1 . . . . A 3 DC H2' . 34631 1 28 . 1 . 1 3 3 DC H2'' H 1 2.458 0.011 . 1 . . . . A 3 DC H2'' . 34631 1 29 . 1 . 1 3 3 DC H3' H 1 4.758 0.000 . 1 . . . . A 3 DC H3' . 34631 1 30 . 1 . 1 3 3 DC H4' H 1 4.227 0.002 . 1 . . . . A 3 DC H4' . 34631 1 31 . 1 . 1 3 3 DC H5 H 1 5.924 0.000 . 1 . . . . A 3 DC H5 . 34631 1 32 . 1 . 1 3 3 DC H5' H 1 4.023 0.000 . 1 . . . . A 3 DC H5' . 34631 1 33 . 1 . 1 3 3 DC H6 H 1 7.728 0.001 . 1 . . . . A 3 DC H6 . 34631 1 34 . 1 . 1 3 3 DC C1' C 13 85.901 0.000 . 1 . . . . A 3 DC C1' . 34631 1 35 . 1 . 1 3 3 DC C2' C 13 38.662 0.010 . 1 . . . . A 3 DC C2' . 34631 1 36 . 1 . 1 3 3 DC C6 C 13 141.251 0.000 . 1 . . . . A 3 DC C6 . 34631 1 37 . 1 . 1 4 4 DT H1' H 1 5.679 0.003 . 1 . . . . A 4 DT H1' . 34631 1 38 . 1 . 1 4 4 DT H2' H 1 1.681 0.011 . 1 . . . . A 4 DT H2' . 34631 1 39 . 1 . 1 4 4 DT H2'' H 1 2.027 0.009 . 1 . . . . A 4 DT H2'' . 34631 1 40 . 1 . 1 4 4 DT H3' H 1 4.732 0.000 . 1 . . . . A 4 DT H3' . 34631 1 41 . 1 . 1 4 4 DT H4' H 1 4.496 0.004 . 1 . . . . A 4 DT H4' . 34631 1 42 . 1 . 1 4 4 DT H5' H 1 4.050 0.004 . 1 . . . . A 4 DT H5' . 34631 1 43 . 1 . 1 4 4 DT H5'' H 1 3.956 0.011 . 1 . . . . A 4 DT H5'' . 34631 1 44 . 1 . 1 4 4 DT H6 H 1 7.220 0.003 . 1 . . . . A 4 DT H6 . 34631 1 45 . 1 . 1 4 4 DT H71 H 1 1.645 0.013 . 1 . . . . A 4 DT H71 . 34631 1 46 . 1 . 1 4 4 DT H72 H 1 1.645 0.013 . 1 . . . . A 4 DT H72 . 34631 1 47 . 1 . 1 4 4 DT H73 H 1 1.645 0.013 . 1 . . . . A 4 DT H73 . 34631 1 48 . 1 . 1 4 4 DT C1' C 13 84.691 0.000 . 1 . . . . A 4 DT C1' . 34631 1 49 . 1 . 1 4 4 DT C2' C 13 38.052 0.000 . 1 . . . . A 4 DT C2' . 34631 1 50 . 1 . 1 4 4 DT C6 C 13 136.215 0.000 . 1 . . . . A 4 DT C6 . 34631 1 51 . 1 . 1 4 4 DT C7 C 13 11.799 0.000 . 1 . . . . A 4 DT C7 . 34631 1 52 . 1 . 1 5 5 DT H1' H 1 5.726 0.004 . 1 . . . . A 5 DT H1' . 34631 1 53 . 1 . 1 5 5 DT H2' H 1 1.721 0.012 . 1 . . . . A 5 DT H2' . 34631 1 54 . 1 . 1 5 5 DT H2'' H 1 1.966 0.011 . 1 . . . . A 5 DT H2'' . 34631 1 55 . 1 . 1 5 5 DT H4' H 1 4.353 0.006 . 1 . . . . A 5 DT H4' . 34631 1 56 . 1 . 1 5 5 DT H5' H 1 3.416 0.045 . 1 . . . . A 5 DT H5' . 34631 1 57 . 1 . 1 5 5 DT H6 H 1 7.143 0.002 . 1 . . . . A 5 DT H6 . 34631 1 58 . 1 . 1 5 5 DT H71 H 1 1.376 0.015 . 1 . . . . A 5 DT H71 . 34631 1 59 . 1 . 1 5 5 DT H72 H 1 1.376 0.015 . 1 . . . . A 5 DT H72 . 34631 1 60 . 1 . 1 5 5 DT H73 H 1 1.376 0.015 . 1 . . . . A 5 DT H73 . 34631 1 61 . 1 . 1 5 5 DT C1' C 13 84.307 0.000 . 1 . . . . A 5 DT C1' . 34631 1 62 . 1 . 1 5 5 DT C2' C 13 38.444 0.009 . 1 . . . . A 5 DT C2' . 34631 1 63 . 1 . 1 5 5 DT C4' C 13 85.599 0.000 . 1 . . . . A 5 DT C4' . 34631 1 64 . 1 . 1 5 5 DT C6 C 13 136.159 0.000 . 1 . . . . A 5 DT C6 . 34631 1 65 . 1 . 1 5 5 DT C7 C 13 11.734 0.000 . 1 . . . . A 5 DT C7 . 34631 1 66 . 1 . 1 6 6 DA H1' H 1 5.992 0.007 . 1 . . . . A 6 DA H1' . 34631 1 67 . 1 . 1 6 6 DA H2 H 1 7.818 0.000 . 1 . . . . A 6 DA H2 . 34631 1 68 . 1 . 1 6 6 DA H2' H 1 2.326 0.004 . 1 . . . . A 6 DA H2' . 34631 1 69 . 1 . 1 6 6 DA H2'' H 1 2.621 0.003 . 1 . . . . A 6 DA H2'' . 34631 1 70 . 1 . 1 6 6 DA H3' H 1 4.731 0.002 . 1 . . . . A 6 DA H3' . 34631 1 71 . 1 . 1 6 6 DA H4' H 1 4.117 0.005 . 1 . . . . A 6 DA H4' . 34631 1 72 . 1 . 1 6 6 DA H5' H 1 4.008 0.000 . 1 . . . . A 6 DA H5' . 34631 1 73 . 1 . 1 6 6 DA H8 H 1 7.449 0.007 . 1 . . . . A 6 DA H8 . 34631 1 74 . 1 . 1 6 6 DA C1' C 13 83.851 0.000 . 1 . . . . A 6 DA C1' . 34631 1 75 . 1 . 1 6 6 DA C2 C 13 152.485 0.000 . 1 . . . . A 6 DA C2 . 34631 1 76 . 1 . 1 6 6 DA C8 C 13 136.933 0.000 . 1 . . . . A 6 DA C8 . 34631 1 77 . 1 . 1 7 7 DG H1 H 1 11.271 0.006 . 1 . . . . A 7 DG H1 . 34631 1 78 . 1 . 1 7 7 DG H1' H 1 5.691 0.004 . 1 . . . . A 7 DG H1' . 34631 1 79 . 1 . 1 7 7 DG H2' H 1 2.495 0.011 . 1 . . . . A 7 DG H2' . 34631 1 80 . 1 . 1 7 7 DG H2'' H 1 3.000 0.011 . 1 . . . . A 7 DG H2'' . 34631 1 81 . 1 . 1 7 7 DG H3' H 1 4.721 0.000 . 1 . . . . A 7 DG H3' . 34631 1 82 . 1 . 1 7 7 DG H4' H 1 4.170 0.006 . 1 . . . . A 7 DG H4' . 34631 1 83 . 1 . 1 7 7 DG H5' H 1 3.990 0.005 . 1 . . . . A 7 DG H5' . 34631 1 84 . 1 . 1 7 7 DG H8 H 1 7.125 0.004 . 1 . . . . A 7 DG H8 . 34631 1 85 . 1 . 1 7 7 DG C1' C 13 86.062 0.000 . 1 . . . . A 7 DG C1' . 34631 1 86 . 1 . 1 7 7 DG C2' C 13 33.287 0.004 . 1 . . . . A 7 DG C2' . 34631 1 87 . 1 . 1 7 7 DG C8 C 13 138.729 0.000 . 1 . . . . A 7 DG C8 . 34631 1 88 . 1 . 1 8 8 DG H1 H 1 11.700 0.002 . 1 . . . . A 8 DG H1 . 34631 1 89 . 1 . 1 8 8 DG H1' H 1 5.778 0.001 . 1 . . . . A 8 DG H1' . 34631 1 90 . 1 . 1 8 8 DG H2' H 1 2.314 0.012 . 1 . . . . A 8 DG H2' . 34631 1 91 . 1 . 1 8 8 DG H2'' H 1 2.526 0.009 . 1 . . . . A 8 DG H2'' . 34631 1 92 . 1 . 1 8 8 DG H3' H 1 4.756 0.006 . 1 . . . . A 8 DG H3' . 34631 1 93 . 1 . 1 8 8 DG H4' H 1 4.292 0.007 . 1 . . . . A 8 DG H4' . 34631 1 94 . 1 . 1 8 8 DG H5' H 1 3.870 0.008 . 1 . . . . A 8 DG H5' . 34631 1 95 . 1 . 1 8 8 DG H8 H 1 7.816 0.001 . 1 . . . . A 8 DG H8 . 34631 1 96 . 1 . 1 8 8 DG C1' C 13 81.255 0.000 . 1 . . . . A 8 DG C1' . 34631 1 97 . 1 . 1 8 8 DG C2' C 13 36.201 0.009 . 1 . . . . A 8 DG C2' . 34631 1 98 . 1 . 1 8 8 DG C8 C 13 135.975 0.000 . 1 . . . . A 8 DG C8 . 34631 1 99 . 1 . 1 9 9 DC H1' H 1 5.409 0.002 . 1 . . . . A 9 DC H1' . 34631 1 100 . 1 . 1 9 9 DC H2' H 1 0.977 0.007 . 1 . . . . A 9 DC H2' . 34631 1 101 . 1 . 1 9 9 DC H2'' H 1 1.983 0.008 . 1 . . . . A 9 DC H2'' . 34631 1 102 . 1 . 1 9 9 DC H3' H 1 4.749 0.000 . 1 . . . . A 9 DC H3' . 34631 1 103 . 1 . 1 9 9 DC H4' H 1 3.732 0.004 . 1 . . . . A 9 DC H4' . 34631 1 104 . 1 . 1 9 9 DC H5 H 1 5.337 0.004 . 1 . . . . A 9 DC H5 . 34631 1 105 . 1 . 1 9 9 DC H5' H 1 4.204 0.007 . 1 . . . . A 9 DC H5' . 34631 1 106 . 1 . 1 9 9 DC H5'' H 1 3.877 0.009 . 1 . . . . A 9 DC H5'' . 34631 1 107 . 1 . 1 9 9 DC H6 H 1 6.859 0.004 . 1 . . . . A 9 DC H6 . 34631 1 108 . 1 . 1 9 9 DC C1' C 13 82.545 0.000 . 1 . . . . A 9 DC C1' . 34631 1 109 . 1 . 1 9 9 DC C2' C 13 37.118 0.015 . 1 . . . . A 9 DC C2' . 34631 1 110 . 1 . 1 9 9 DC C4' C 13 80.890 0.000 . 1 . . . . A 9 DC C4' . 34631 1 111 . 1 . 1 9 9 DC C6 C 13 138.897 0.000 . 1 . . . . A 9 DC C6 . 34631 1 112 . 1 . 1 10 10 DT H1' H 1 6.303 0.003 . 1 . . . . A 10 DT H1' . 34631 1 113 . 1 . 1 10 10 DT H2' H 1 1.935 0.010 . 1 . . . . A 10 DT H2' . 34631 1 114 . 1 . 1 10 10 DT H3' H 1 4.909 0.007 . 1 . . . . A 10 DT H3' . 34631 1 115 . 1 . 1 10 10 DT H4' H 1 4.397 0.002 . 1 . . . . A 10 DT H4' . 34631 1 116 . 1 . 1 10 10 DT H5' H 1 3.377 0.006 . 1 . . . . A 10 DT H5' . 34631 1 117 . 1 . 1 10 10 DT H5'' H 1 3.305 0.012 . 1 . . . . A 10 DT H5'' . 34631 1 118 . 1 . 1 10 10 DT H6 H 1 6.960 0.002 . 1 . . . . A 10 DT H6 . 34631 1 119 . 1 . 1 10 10 DT H71 H 1 1.287 0.011 . 1 . . . . A 10 DT H71 . 34631 1 120 . 1 . 1 10 10 DT H72 H 1 1.287 0.011 . 1 . . . . A 10 DT H72 . 34631 1 121 . 1 . 1 10 10 DT H73 H 1 1.287 0.011 . 1 . . . . A 10 DT H73 . 34631 1 122 . 1 . 1 10 10 DT C2' C 13 35.875 0.000 . 1 . . . . A 10 DT C2' . 34631 1 123 . 1 . 1 10 10 DT C6 C 13 137.247 0.000 . 1 . . . . A 10 DT C6 . 34631 1 124 . 1 . 1 10 10 DT C7 C 13 11.047 0.000 . 1 . . . . A 10 DT C7 . 34631 1 125 . 1 . 1 11 11 DT H1' H 1 5.273 0.001 . 1 . . . . A 11 DT H1' . 34631 1 126 . 1 . 1 11 11 DT H2' H 1 1.587 0.011 . 1 . . . . A 11 DT H2' . 34631 1 127 . 1 . 1 11 11 DT H2'' H 1 2.304 0.012 . 1 . . . . A 11 DT H2'' . 34631 1 128 . 1 . 1 11 11 DT H3 H 1 10.133 0.001 . 1 . . . . A 11 DT H3 . 34631 1 129 . 1 . 1 11 11 DT H3' H 1 4.554 0.001 . 1 . . . . A 11 DT H3' . 34631 1 130 . 1 . 1 11 11 DT H4' H 1 4.287 0.003 . 1 . . . . A 11 DT H4' . 34631 1 131 . 1 . 1 11 11 DT H5' H 1 3.973 0.012 . 1 . . . . A 11 DT H5' . 34631 1 132 . 1 . 1 11 11 DT H5'' H 1 3.833 0.001 . 1 . . . . A 11 DT H5'' . 34631 1 133 . 1 . 1 11 11 DT H6 H 1 6.970 0.003 . 1 . . . . A 11 DT H6 . 34631 1 134 . 1 . 1 11 11 DT H71 H 1 1.330 0.012 . 1 . . . . A 11 DT H71 . 34631 1 135 . 1 . 1 11 11 DT H72 H 1 1.330 0.012 . 1 . . . . A 11 DT H72 . 34631 1 136 . 1 . 1 11 11 DT H73 H 1 1.330 0.012 . 1 . . . . A 11 DT H73 . 34631 1 137 . 1 . 1 11 11 DT C1' C 13 88.504 0.000 . 1 . . . . A 11 DT C1' . 34631 1 138 . 1 . 1 11 11 DT C2' C 13 40.485 0.033 . 1 . . . . A 11 DT C2' . 34631 1 139 . 1 . 1 11 11 DT C6 C 13 136.712 0.000 . 1 . . . . A 11 DT C6 . 34631 1 140 . 1 . 1 11 11 DT C7 C 13 11.779 0.000 . 1 . . . . A 11 DT C7 . 34631 1 141 . 1 . 1 12 12 DA H1' H 1 6.089 0.001 . 1 . . . . A 12 DA H1' . 34631 1 142 . 1 . 1 12 12 DA H2 H 1 7.569 0.000 . 1 . . . . A 12 DA H2 . 34631 1 143 . 1 . 1 12 12 DA H2' H 1 2.232 0.014 . 1 . . . . A 12 DA H2' . 34631 1 144 . 1 . 1 12 12 DA H2'' H 1 2.514 0.013 . 1 . . . . A 12 DA H2'' . 34631 1 145 . 1 . 1 12 12 DA H3' H 1 4.776 0.000 . 1 . . . . A 12 DA H3' . 34631 1 146 . 1 . 1 12 12 DA H4' H 1 4.378 0.001 . 1 . . . . A 12 DA H4' . 34631 1 147 . 1 . 1 12 12 DA H5' H 1 2.853 0.005 . 1 . . . . A 12 DA H5' . 34631 1 148 . 1 . 1 12 12 DA H5'' H 1 2.631 0.005 . 1 . . . . A 12 DA H5'' . 34631 1 149 . 1 . 1 12 12 DA H8 H 1 7.978 0.001 . 1 . . . . A 12 DA H8 . 34631 1 150 . 1 . 1 12 12 DA C1' C 13 82.582 0.000 . 1 . . . . A 12 DA C1' . 34631 1 151 . 1 . 1 12 12 DA C2 C 13 151.816 0.000 . 1 . . . . A 12 DA C2 . 34631 1 152 . 1 . 1 12 12 DA C2' C 13 40.195 0.002 . 1 . . . . A 12 DA C2' . 34631 1 153 . 1 . 1 12 12 DA C8 C 13 139.722 0.000 . 1 . . . . A 12 DA C8 . 34631 1 154 . 1 . 1 13 13 DG H1 H 1 11.912 0.001 . 1 . . . . A 13 DG H1 . 34631 1 155 . 1 . 1 13 13 DG H1' H 1 5.874 0.006 . 1 . . . . A 13 DG H1' . 34631 1 156 . 1 . 1 13 13 DG H2' H 1 2.304 0.026 . 1 . . . . A 13 DG H2' . 34631 1 157 . 1 . 1 13 13 DG H3' H 1 4.748 0.003 . 1 . . . . A 13 DG H3' . 34631 1 158 . 1 . 1 13 13 DG H4' H 1 4.281 0.001 . 1 . . . . A 13 DG H4' . 34631 1 159 . 1 . 1 13 13 DG H5' H 1 4.091 0.002 . 1 . . . . A 13 DG H5' . 34631 1 160 . 1 . 1 13 13 DG H8 H 1 7.328 0.002 . 1 . . . . A 13 DG H8 . 34631 1 161 . 1 . 1 13 13 DG C1' C 13 80.925 0.000 . 1 . . . . A 13 DG C1' . 34631 1 162 . 1 . 1 13 13 DG C2' C 13 38.282 0.000 . 1 . . . . A 13 DG C2' . 34631 1 163 . 1 . 1 13 13 DG C8 C 13 139.413 0.000 . 1 . . . . A 13 DG C8 . 34631 1 164 . 1 . 1 14 14 DG H1 H 1 11.730 0.003 . 1 . . . . A 14 DG H1 . 34631 1 165 . 1 . 1 14 14 DG H1' H 1 5.877 0.003 . 1 . . . . A 14 DG H1' . 34631 1 166 . 1 . 1 14 14 DG H2' H 1 2.635 0.012 . 1 . . . . A 14 DG H2' . 34631 1 167 . 1 . 1 14 14 DG H2'' H 1 3.211 0.014 . 1 . . . . A 14 DG H2'' . 34631 1 168 . 1 . 1 14 14 DG H3' H 1 4.745 0.000 . 1 . . . . A 14 DG H3' . 34631 1 169 . 1 . 1 14 14 DG H4' H 1 4.278 0.001 . 1 . . . . A 14 DG H4' . 34631 1 170 . 1 . 1 14 14 DG H5' H 1 4.083 0.005 . 1 . . . . A 14 DG H5' . 34631 1 171 . 1 . 1 14 14 DG H5'' H 1 3.954 0.004 . 1 . . . . A 14 DG H5'' . 34631 1 172 . 1 . 1 14 14 DG H8 H 1 7.462 0.003 . 1 . . . . A 14 DG H8 . 34631 1 173 . 1 . 1 14 14 DG C1' C 13 86.773 0.000 . 1 . . . . A 14 DG C1' . 34631 1 174 . 1 . 1 14 14 DG C2' C 13 32.445 0.009 . 1 . . . . A 14 DG C2' . 34631 1 175 . 1 . 1 14 14 DG C8 C 13 134.621 0.000 . 1 . . . . A 14 DG C8 . 34631 1 176 . 1 . 1 15 15 DC H1' H 1 6.221 0.003 . 1 . . . . A 15 DC H1' . 34631 1 177 . 1 . 1 15 15 DC H2' H 1 2.206 0.012 . 1 . . . . A 15 DC H2' . 34631 1 178 . 1 . 1 15 15 DC H2'' H 1 2.444 0.013 . 1 . . . . A 15 DC H2'' . 34631 1 179 . 1 . 1 15 15 DC H3' H 1 4.829 0.003 . 1 . . . . A 15 DC H3' . 34631 1 180 . 1 . 1 15 15 DC H4' H 1 4.363 0.001 . 1 . . . . A 15 DC H4' . 34631 1 181 . 1 . 1 15 15 DC H5 H 1 6.081 0.000 . 1 . . . . A 15 DC H5 . 34631 1 182 . 1 . 1 15 15 DC H5' H 1 4.158 0.008 . 1 . . . . A 15 DC H5' . 34631 1 183 . 1 . 1 15 15 DC H5'' H 1 4.033 0.004 . 1 . . . . A 15 DC H5'' . 34631 1 184 . 1 . 1 15 15 DC H6 H 1 7.909 0.004 . 1 . . . . A 15 DC H6 . 34631 1 185 . 1 . 1 15 15 DC C1' C 13 86.494 0.000 . 1 . . . . A 15 DC C1' . 34631 1 186 . 1 . 1 15 15 DC C2' C 13 39.293 0.003 . 1 . . . . A 15 DC C2' . 34631 1 187 . 1 . 1 15 15 DC C6 C 13 140.861 0.000 . 1 . . . . A 15 DC C6 . 34631 1 188 . 1 . 1 16 16 DT H1' H 1 6.201 0.003 . 1 . . . . A 16 DT H1' . 34631 1 189 . 1 . 1 16 16 DT H2' H 1 2.202 0.014 . 1 . . . . A 16 DT H2' . 34631 1 190 . 1 . 1 16 16 DT H2'' H 1 2.292 0.009 . 1 . . . . A 16 DT H2'' . 34631 1 191 . 1 . 1 16 16 DT H3' H 1 4.675 0.002 . 1 . . . . A 16 DT H3' . 34631 1 192 . 1 . 1 16 16 DT H4' H 1 4.183 0.002 . 1 . . . . A 16 DT H4' . 34631 1 193 . 1 . 1 16 16 DT H5' H 1 3.993 0.004 . 1 . . . . A 16 DT H5' . 34631 1 194 . 1 . 1 16 16 DT H6 H 1 7.601 0.001 . 1 . . . . A 16 DT H6 . 34631 1 195 . 1 . 1 16 16 DT H71 H 1 1.764 0.019 . 1 . . . . A 16 DT H71 . 34631 1 196 . 1 . 1 16 16 DT H72 H 1 1.764 0.019 . 1 . . . . A 16 DT H72 . 34631 1 197 . 1 . 1 16 16 DT H73 H 1 1.764 0.019 . 1 . . . . A 16 DT H73 . 34631 1 198 . 1 . 1 16 16 DT C1' C 13 84.963 0.000 . 1 . . . . A 16 DT C1' . 34631 1 199 . 1 . 1 16 16 DT C2' C 13 38.291 0.004 . 1 . . . . A 16 DT C2' . 34631 1 200 . 1 . 1 16 16 DT C6 C 13 137.191 0.000 . 1 . . . . A 16 DT C6 . 34631 1 201 . 1 . 1 16 16 DT C7 C 13 11.566 0.000 . 1 . . . . A 16 DT C7 . 34631 1 202 . 1 . 1 17 17 DT H1' H 1 5.520 0.001 . 1 . . . . A 17 DT H1' . 34631 1 203 . 1 . 1 17 17 DT H2' H 1 0.915 0.007 . 1 . . . . A 17 DT H2' . 34631 1 204 . 1 . 1 17 17 DT H2'' H 1 1.378 0.005 . 1 . . . . A 17 DT H2'' . 34631 1 205 . 1 . 1 17 17 DT H3' H 1 4.535 0.004 . 1 . . . . A 17 DT H3' . 34631 1 206 . 1 . 1 17 17 DT H4' H 1 4.183 0.006 . 1 . . . . A 17 DT H4' . 34631 1 207 . 1 . 1 17 17 DT H5' H 1 3.947 0.004 . 1 . . . . A 17 DT H5' . 34631 1 208 . 1 . 1 17 17 DT H5'' H 1 3.730 0.010 . 1 . . . . A 17 DT H5'' . 34631 1 209 . 1 . 1 17 17 DT H6 H 1 6.959 0.002 . 1 . . . . A 17 DT H6 . 34631 1 210 . 1 . 1 17 17 DT H71 H 1 1.351 0.014 . 1 . . . . A 17 DT H71 . 34631 1 211 . 1 . 1 17 17 DT H72 H 1 1.351 0.014 . 1 . . . . A 17 DT H72 . 34631 1 212 . 1 . 1 17 17 DT H73 H 1 1.351 0.014 . 1 . . . . A 17 DT H73 . 34631 1 213 . 1 . 1 17 17 DT C1' C 13 84.384 0.000 . 1 . . . . A 17 DT C1' . 34631 1 214 . 1 . 1 17 17 DT C2' C 13 36.451 0.020 . 1 . . . . A 17 DT C2' . 34631 1 215 . 1 . 1 17 17 DT C6 C 13 135.016 0.000 . 1 . . . . A 17 DT C6 . 34631 1 216 . 1 . 1 17 17 DT C7 C 13 11.297 0.000 . 1 . . . . A 17 DT C7 . 34631 1 217 . 1 . 1 18 18 DA H1' H 1 6.140 0.003 . 1 . . . . A 18 DA H1' . 34631 1 218 . 1 . 1 18 18 DA H2 H 1 8.162 0.001 . 1 . . . . A 18 DA H2 . 34631 1 219 . 1 . 1 18 18 DA H2' H 1 2.650 0.014 . 1 . . . . A 18 DA H2' . 34631 1 220 . 1 . 1 18 18 DA H2'' H 1 2.851 0.014 . 1 . . . . A 18 DA H2'' . 34631 1 221 . 1 . 1 18 18 DA H3' H 1 4.864 0.000 . 1 . . . . A 18 DA H3' . 34631 1 222 . 1 . 1 18 18 DA H4' H 1 4.238 0.002 . 1 . . . . A 18 DA H4' . 34631 1 223 . 1 . 1 18 18 DA H5' H 1 3.837 0.005 . 1 . . . . A 18 DA H5' . 34631 1 224 . 1 . 1 18 18 DA H5'' H 1 3.658 0.004 . 1 . . . . A 18 DA H5'' . 34631 1 225 . 1 . 1 18 18 DA H8 H 1 8.127 0.002 . 1 . . . . A 18 DA H8 . 34631 1 226 . 1 . 1 18 18 DA C1' C 13 82.936 0.000 . 1 . . . . A 18 DA C1' . 34631 1 227 . 1 . 1 18 18 DA C2 C 13 153.112 0.000 . 1 . . . . A 18 DA C2 . 34631 1 228 . 1 . 1 18 18 DA C2' C 13 36.239 0.001 . 1 . . . . A 18 DA C2' . 34631 1 229 . 1 . 1 18 18 DA C8 C 13 138.395 0.000 . 1 . . . . A 18 DA C8 . 34631 1 230 . 1 . 1 19 19 DG H1 H 1 11.566 0.006 . 1 . . . . A 19 DG H1 . 34631 1 231 . 1 . 1 19 19 DG H1' H 1 5.896 0.001 . 1 . . . . A 19 DG H1' . 34631 1 232 . 1 . 1 19 19 DG H2' H 1 2.807 0.013 . 1 . . . . A 19 DG H2' . 34631 1 233 . 1 . 1 19 19 DG H2'' H 1 3.384 0.017 . 1 . . . . A 19 DG H2'' . 34631 1 234 . 1 . 1 19 19 DG H3' H 1 4.801 0.005 . 1 . . . . A 19 DG H3' . 34631 1 235 . 1 . 1 19 19 DG H4' H 1 4.370 0.004 . 1 . . . . A 19 DG H4' . 34631 1 236 . 1 . 1 19 19 DG H5' H 1 4.162 0.007 . 1 . . . . A 19 DG H5' . 34631 1 237 . 1 . 1 19 19 DG H5'' H 1 4.043 0.006 . 1 . . . . A 19 DG H5'' . 34631 1 238 . 1 . 1 19 19 DG H8 H 1 7.152 0.002 . 1 . . . . A 19 DG H8 . 34631 1 239 . 1 . 1 19 19 DG C1' C 13 86.753 0.000 . 1 . . . . A 19 DG C1' . 34631 1 240 . 1 . 1 19 19 DG C2' C 13 32.722 0.003 . 1 . . . . A 19 DG C2' . 34631 1 241 . 1 . 1 19 19 DG C8 C 13 139.058 0.000 . 1 . . . . A 19 DG C8 . 34631 1 242 . 1 . 1 20 20 DG H1 H 1 11.540 0.001 . 1 . . . . A 20 DG H1 . 34631 1 243 . 1 . 1 20 20 DG H1' H 1 6.017 0.002 . 1 . . . . A 20 DG H1' . 34631 1 244 . 1 . 1 20 20 DG H2' H 1 2.214 0.018 . 1 . . . . A 20 DG H2' . 34631 1 245 . 1 . 1 20 20 DG H2'' H 1 2.443 0.016 . 1 . . . . A 20 DG H2'' . 34631 1 246 . 1 . 1 20 20 DG H3' H 1 4.603 0.000 . 1 . . . . A 20 DG H3' . 34631 1 247 . 1 . 1 20 20 DG H4' H 1 4.373 0.000 . 1 . . . . A 20 DG H4' . 34631 1 248 . 1 . 1 20 20 DG H5' H 1 4.187 0.004 . 1 . . . . A 20 DG H5' . 34631 1 249 . 1 . 1 20 20 DG H5'' H 1 4.083 0.001 . 1 . . . . A 20 DG H5'' . 34631 1 250 . 1 . 1 20 20 DG H8 H 1 8.042 0.001 . 1 . . . . A 20 DG H8 . 34631 1 251 . 1 . 1 20 20 DG C1' C 13 81.069 0.000 . 1 . . . . A 20 DG C1' . 34631 1 252 . 1 . 1 20 20 DG C2' C 13 39.862 0.004 . 1 . . . . A 20 DG C2' . 34631 1 253 . 1 . 1 20 20 DG C8 C 13 136.341 0.000 . 1 . . . . A 20 DG C8 . 34631 1 stop_ save_