data_34674 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34674 _Entry.Title ; Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-10-29 _Entry.Accession_date 2021-10-29 _Entry.Last_release_date 2021-11-29 _Entry.Original_release_date 2021-11-29 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Z. Wang Z. . . . 34674 2 S. Jurt S. . . . 34674 3 A. Dominguez-Martin A. . . . 34674 4 S. Johannsen S. . . . 34674 5 R. Sigel R. K.O. . . 34674 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 5'UTR . 34674 BCL-2 . 34674 G-quadruplex . 34674 RNA . 34674 intramolecular . 34674 mRNA . 34674 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34674 spectral_peak_list 1 34674 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 179 34674 '15N chemical shifts' 69 34674 '1H chemical shifts' 184 34674 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-11-08 . original BMRB . 34674 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7Q48 'BMRB Entry Tracking System' 34674 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34674 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Z. Wang Z. . . . 34674 1 2 S. Jurt S. . . . 34674 1 3 A. Dominguez-Martin A. . . . 34674 1 4 S. Johannsen S. . . . 34674 1 5 R. Sigel R. K.O. . . 34674 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34674 _Assembly.ID 1 _Assembly.Name "RNA (5'-R(*GP*GP*GP*CP*CP*AP*UP*UP*GP*GP*GP*UP*GP*GP*GP*AP*UP*CP*UP*GP*GP*G)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34674 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34674 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCCAUUGGGUGGGAUCUG GG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7202.299 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 34674 1 2 . G . 34674 1 3 . G . 34674 1 4 . C . 34674 1 5 . C . 34674 1 6 . A . 34674 1 7 . U . 34674 1 8 . U . 34674 1 9 . G . 34674 1 10 . G . 34674 1 11 . G . 34674 1 12 . U . 34674 1 13 . G . 34674 1 14 . G . 34674 1 15 . G . 34674 1 16 . A . 34674 1 17 . U . 34674 1 18 . C . 34674 1 19 . U . 34674 1 20 . G . 34674 1 21 . G . 34674 1 22 . G . 34674 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 34674 1 . G 2 2 34674 1 . G 3 3 34674 1 . C 4 4 34674 1 . C 5 5 34674 1 . A 6 6 34674 1 . U 7 7 34674 1 . U 8 8 34674 1 . G 9 9 34674 1 . G 10 10 34674 1 . G 11 11 34674 1 . U 12 12 34674 1 . G 13 13 34674 1 . G 14 14 34674 1 . G 15 15 34674 1 . A 16 16 34674 1 . U 17 17 34674 1 . C 18 18 34674 1 . U 19 19 34674 1 . G 20 20 34674 1 . G 21 21 34674 1 . G 22 22 34674 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34674 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 34674 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34674 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34674 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34674 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.0 mM BCL-2 6A8U17U, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' 'natural abundance' . . 1 $entity_1 . . 1.0 . . mM . . . . 34674 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34674 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.0 mM BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' 'natural abundance' . . 1 $entity_1 . . 1.0 . . mM . . . . 34674 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 34674 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM G & U 15N-labeled BCL-2 6A8U17U, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[G & U 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34674 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 34674 _Sample.ID 4 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM G & U 15N-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[G & U 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34674 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 34674 _Sample.ID 5 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM A & C 15N-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[A & C 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34674 5 stop_ save_ save_sample_6 _Sample.Sf_category sample _Sample.Sf_framecode sample_6 _Sample.Entry_ID 34674 _Sample.ID 6 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM A 13C, 15N-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[A 13C, 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34674 6 stop_ save_ save_sample_7 _Sample.Sf_category sample _Sample.Sf_framecode sample_7 _Sample.Entry_ID 34674 _Sample.ID 7 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.3 mM C 13C, 15N-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[C 13C, 15N-labeled]' . . 1 $entity_1 . . 0.3 . . mM . . . . 34674 7 stop_ save_ save_sample_8 _Sample.Sf_category sample _Sample.Sf_framecode sample_8 _Sample.Entry_ID 34674 _Sample.ID 8 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.3 mM G 13C-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[G 13C-labeled]' . . 1 $entity_1 . . 0.3 . . mM . . . . 34674 8 stop_ save_ save_sample_9 _Sample.Sf_category sample _Sample.Sf_framecode sample_9 _Sample.Entry_ID 34674 _Sample.ID 9 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM U 13C, 15N-labeled BCL-2 6A8U17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8U17U' '[U 13C, 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34674 9 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 1 pH 7.0 . pH 34674 1 pressure 1 . atm 34674 1 temperature 298 . K 34674 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 2 pH 7.0 . pH 34674 2 pressure 1 . atm 34674 2 temperature 298 . K 34674 2 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 3 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 3 pH 7.0 . pH 34674 3 pressure 1 . atm 34674 3 temperature 298 . K 34674 3 stop_ save_ save_sample_conditions_4 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_4 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 4 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 4 pH 7.0 . pH 34674 4 pressure 1 . atm 34674 4 temperature 298 . K 34674 4 stop_ save_ save_sample_conditions_5 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_5 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 5 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 5 pH 7.0 . pH 34674 5 pressure 1 . atm 34674 5 temperature 298 . K 34674 5 stop_ save_ save_sample_conditions_6 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_6 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 6 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 6 pH 7.0 . pH 34674 6 pressure 1 . atm 34674 6 temperature 298 . K 34674 6 stop_ save_ save_sample_conditions_7 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_7 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 7 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 7 pH 7.0 . pH 34674 7 pressure 1 . atm 34674 7 temperature 298 . K 34674 7 stop_ save_ save_sample_conditions_8 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_8 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 8 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 8 pH 7.0 . pH 34674 8 pressure 1 . atm 34674 8 temperature 298 . K 34674 8 stop_ save_ save_sample_conditions_9 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_9 _Sample_condition_list.Entry_ID 34674 _Sample_condition_list.ID 9 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34674 9 pH 7.0 . pH 34674 9 pressure 1 . atm 34674 9 temperature 298 . K 34674 9 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34674 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version 4.0.6 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 34674 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 34674 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34674 _Software.ID 2 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version 1.414 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee W, Tonelli M, Markley JL' . . 34674 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34674 2 'peak picking' . 34674 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34674 _Software.ID 3 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version 3.0 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 34674 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34674 3 'structure calculation' . 34674 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34674 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details Cryo-TCI _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 34674 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name . _NMR_spectrometer.Details Cryo-TXI _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34674 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 600 . . . 34674 1 2 NMR_spectrometer_2 Bruker AVANCE . 700 . . . 34674 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34674 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 3 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 4 '2D 1H-13C HSQC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 5 '2D 1H-15N HSQC' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 6 JR-HMBC no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 7 'H8N2 HNN-COSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 8 'H1N2 HNN-COSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 9 'H1pC6/8 HMBC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 10 'long-range 1H-15N HSQC' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 4 $sample_conditions_4 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 11 'long-range 1H-15N HSQC' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 5 $sample_conditions_5 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 12 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 6 $sample_6 isotropic . . 6 $sample_conditions_6 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 13 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 7 $sample_7 isotropic . . 7 $sample_conditions_7 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 14 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 8 $sample_8 isotropic . . 8 $sample_conditions_8 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34674 1 15 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 9 $sample_9 isotropic . . 9 $sample_conditions_9 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34674 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34674 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0 external indirect 0.25144953 . . . . . 34674 1 H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1 . . . . . 34674 1 N 15 DSS 'methyl protons' . . . . ppm 0 external indirect 0.10132912 . . . . . 34674 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34674 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details 'non-exchangeable protons were assigned based on Sample 2 and exchangeable protons were assigned based on Sample 1' _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34674 1 2 '2D 1H-1H NOESY' . . . 34674 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 34674 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1 H 1 11.565 0.001 . 1 . . . . A 1 G H1 . 34674 1 2 . 1 . 1 1 1 G H1' H 1 5.838 0.001 . 1 . . . . A 1 G H1' . 34674 1 3 . 1 . 1 1 1 G H2' H 1 4.988 0.001 . 1 . . . . A 1 G H2' . 34674 1 4 . 1 . 1 1 1 G H3' H 1 4.776 0.000 . 1 . . . . A 1 G H3' . 34674 1 5 . 1 . 1 1 1 G H4' H 1 4.643 0.000 . 1 . . . . A 1 G H4' . 34674 1 6 . 1 . 1 1 1 G H5' H 1 4.357 0.001 . 1 . . . . A 1 G H5' . 34674 1 7 . 1 . 1 1 1 G H5'' H 1 4.351 0.001 . 1 . . . . A 1 G H5'' . 34674 1 8 . 1 . 1 1 1 G H8 H 1 8.139 0.001 . 1 . . . . A 1 G H8 . 34674 1 9 . 1 . 1 1 1 G C1' C 13 89.609 0 . 1 . . . . A 1 G C1' . 34674 1 10 . 1 . 1 1 1 G C2' C 13 75.179 0.028 . 1 . . . . A 1 G C2' . 34674 1 11 . 1 . 1 1 1 G C3' C 13 73.523 0.003 . 1 . . . . A 1 G C3' . 34674 1 12 . 1 . 1 1 1 G C4 C 13 154.480 0 . 1 . . . . A 1 G C4 . 34674 1 13 . 1 . 1 1 1 G C4' C 13 84.787 0.020 . 1 . . . . A 1 G C4' . 34674 1 14 . 1 . 1 1 1 G C5 C 13 118.465 0.017 . 1 . . . . A 1 G C5 . 34674 1 15 . 1 . 1 1 1 G C5' C 13 68.710 0.001 . 1 . . . . A 1 G C5' . 34674 1 16 . 1 . 1 1 1 G C8 C 13 138.750 0.000 . 1 . . . . A 1 G C8 . 34674 1 17 . 1 . 1 1 1 G N1 N 15 143.994 0 . 1 . . . . A 1 G N1 . 34674 1 18 . 1 . 1 1 1 G N2 N 15 80.358 0.000 . 1 . . . . A 1 G N2 . 34674 1 19 . 1 . 1 1 1 G N7 N 15 236.270 0 . 1 . . . . A 1 G N7 . 34674 1 20 . 1 . 1 1 1 G N9 N 15 166.257 0 . 1 . . . . A 1 G N9 . 34674 1 21 . 1 . 1 2 2 G H1 H 1 11.694 0.001 . 1 . . . . A 2 G H1 . 34674 1 22 . 1 . 1 2 2 G H1' H 1 6.020 0.001 . 1 . . . . A 2 G H1' . 34674 1 23 . 1 . 1 2 2 G H2' H 1 4.509 0.001 . 1 . . . . A 2 G H2' . 34674 1 24 . 1 . 1 2 2 G H3' H 1 4.772 0.001 . 1 . . . . A 2 G H3' . 34674 1 25 . 1 . 1 2 2 G H4' H 1 4.657 0.001 . 1 . . . . A 2 G H4' . 34674 1 26 . 1 . 1 2 2 G H5' H 1 4.564 0.000 . 1 . . . . A 2 G H5' . 34674 1 27 . 1 . 1 2 2 G H5'' H 1 4.527 0.002 . 1 . . . . A 2 G H5'' . 34674 1 28 . 1 . 1 2 2 G H8 H 1 8.030 0.001 . 1 . . . . A 2 G H8 . 34674 1 29 . 1 . 1 2 2 G H21 H 1 9.844 0 . 1 . . . . A 2 G H21 . 34674 1 30 . 1 . 1 2 2 G H22 H 1 5.933 0 . 1 . . . . A 2 G H22 . 34674 1 31 . 1 . 1 2 2 G C1' C 13 93.385 0.011 . 1 . . . . A 2 G C1' . 34674 1 32 . 1 . 1 2 2 G C2' C 13 75.169 0.027 . 1 . . . . A 2 G C2' . 34674 1 33 . 1 . 1 2 2 G C4 C 13 153.597 0 . 1 . . . . A 2 G C4 . 34674 1 34 . 1 . 1 2 2 G C4' C 13 82.992 0.000 . 1 . . . . A 2 G C4' . 34674 1 35 . 1 . 1 2 2 G C5 C 13 118.067 0.003 . 1 . . . . A 2 G C5 . 34674 1 36 . 1 . 1 2 2 G C5' C 13 67.344 0.007 . 1 . . . . A 2 G C5' . 34674 1 37 . 1 . 1 2 2 G C8 C 13 137.969 0.014 . 1 . . . . A 2 G C8 . 34674 1 38 . 1 . 1 2 2 G N1 N 15 143.585 0 . 1 . . . . A 2 G N1 . 34674 1 39 . 1 . 1 2 2 G N2 N 15 82.400 0.002 . 1 . . . . A 2 G N2 . 34674 1 40 . 1 . 1 2 2 G N7 N 15 233.587 0 . 1 . . . . A 2 G N7 . 34674 1 41 . 1 . 1 2 2 G N9 N 15 169.204 0 . 1 . . . . A 2 G N9 . 34674 1 42 . 1 . 1 3 3 G H1 H 1 11.563 0.002 . 1 . . . . A 3 G H1 . 34674 1 43 . 1 . 1 3 3 G H1' H 1 6.122 0.001 . 1 . . . . A 3 G H1' . 34674 1 44 . 1 . 1 3 3 G H2' H 1 4.290 0.001 . 1 . . . . A 3 G H2' . 34674 1 45 . 1 . 1 3 3 G H3' H 1 4.811 0.000 . 1 . . . . A 3 G H3' . 34674 1 46 . 1 . 1 3 3 G H4' H 1 4.499 0.002 . 1 . . . . A 3 G H4' . 34674 1 47 . 1 . 1 3 3 G H5' H 1 4.671 0.000 . 1 . . . . A 3 G H5' . 34674 1 48 . 1 . 1 3 3 G H5'' H 1 4.159 0.000 . 1 . . . . A 3 G H5'' . 34674 1 49 . 1 . 1 3 3 G H8 H 1 7.907 0.001 . 1 . . . . A 3 G H8 . 34674 1 50 . 1 . 1 3 3 G C1' C 13 91.228 0.069 . 1 . . . . A 3 G C1' . 34674 1 51 . 1 . 1 3 3 G C2' C 13 77.284 0.018 . 1 . . . . A 3 G C2' . 34674 1 52 . 1 . 1 3 3 G C3' C 13 74.488 0.091 . 1 . . . . A 3 G C3' . 34674 1 53 . 1 . 1 3 3 G C4 C 13 153.920 0 . 1 . . . . A 3 G C4 . 34674 1 54 . 1 . 1 3 3 G C4' C 13 83.623 0.013 . 1 . . . . A 3 G C4' . 34674 1 55 . 1 . 1 3 3 G C5 C 13 117.588 0.003 . 1 . . . . A 3 G C5 . 34674 1 56 . 1 . 1 3 3 G C5' C 13 66.302 0.024 . 1 . . . . A 3 G C5' . 34674 1 57 . 1 . 1 3 3 G C8 C 13 137.553 0.004 . 1 . . . . A 3 G C8 . 34674 1 58 . 1 . 1 3 3 G N1 N 15 144.073 0 . 1 . . . . A 3 G N1 . 34674 1 59 . 1 . 1 3 3 G N2 N 15 81.819 0.009 . 1 . . . . A 3 G N2 . 34674 1 60 . 1 . 1 3 3 G N7 N 15 236.371 0 . 1 . . . . A 3 G N7 . 34674 1 61 . 1 . 1 3 3 G N9 N 15 170.290 0 . 1 . . . . A 3 G N9 . 34674 1 62 . 1 . 1 4 4 C H1' H 1 5.774 0.001 . 1 . . . . A 4 C H1' . 34674 1 63 . 1 . 1 4 4 C H2' H 1 4.195 0.001 . 1 . . . . A 4 C H2' . 34674 1 64 . 1 . 1 4 4 C H3' H 1 4.509 0.000 . 1 . . . . A 4 C H3' . 34674 1 65 . 1 . 1 4 4 C H4' H 1 4.088 0.002 . 1 . . . . A 4 C H4' . 34674 1 66 . 1 . 1 4 4 C H5 H 1 5.807 0.000 . 1 . . . . A 4 C H5 . 34674 1 67 . 1 . 1 4 4 C H5' H 1 4.239 0.002 . 1 . . . . A 4 C H5' . 34674 1 68 . 1 . 1 4 4 C H5'' H 1 4.019 0.001 . 1 . . . . A 4 C H5'' . 34674 1 69 . 1 . 1 4 4 C H6 H 1 7.660 0.001 . 1 . . . . A 4 C H6 . 34674 1 70 . 1 . 1 4 4 C C1' C 13 91.355 0.058 . 1 . . . . A 4 C C1' . 34674 1 71 . 1 . 1 4 4 C C2 C 13 159.648 0 . 1 . . . . A 4 C C2 . 34674 1 72 . 1 . 1 4 4 C C2' C 13 76.078 0.068 . 1 . . . . A 4 C C2' . 34674 1 73 . 1 . 1 4 4 C C3' C 13 76.432 0.055 . 1 . . . . A 4 C C3' . 34674 1 74 . 1 . 1 4 4 C C4' C 13 84.512 0.027 . 1 . . . . A 4 C C4' . 34674 1 75 . 1 . 1 4 4 C C5 C 13 98.770 0.093 . 1 . . . . A 4 C C5 . 34674 1 76 . 1 . 1 4 4 C C5' C 13 67.520 0.036 . 1 . . . . A 4 C C5' . 34674 1 77 . 1 . 1 4 4 C C6 C 13 143.314 0.074 . 1 . . . . A 4 C C6 . 34674 1 78 . 1 . 1 4 4 C N1 N 15 150.935 0.003 . 1 . . . . A 4 C N1 . 34674 1 79 . 1 . 1 5 5 C H1' H 1 5.963 0.001 . 1 . . . . A 5 C H1' . 34674 1 80 . 1 . 1 5 5 C H2' H 1 4.314 0.001 . 1 . . . . A 5 C H2' . 34674 1 81 . 1 . 1 5 5 C H3' H 1 4.542 0.002 . 1 . . . . A 5 C H3' . 34674 1 82 . 1 . 1 5 5 C H4' H 1 4.405 0.002 . 1 . . . . A 5 C H4' . 34674 1 83 . 1 . 1 5 5 C H5 H 1 6.005 0.000 . 1 . . . . A 5 C H5 . 34674 1 84 . 1 . 1 5 5 C H5' H 1 4.098 0.002 . 1 . . . . A 5 C H5' . 34674 1 85 . 1 . 1 5 5 C H5'' H 1 4.037 0.001 . 1 . . . . A 5 C H5'' . 34674 1 86 . 1 . 1 5 5 C H6 H 1 7.804 0.001 . 1 . . . . A 5 C H6 . 34674 1 87 . 1 . 1 5 5 C C1' C 13 91.084 0.037 . 1 . . . . A 5 C C1' . 34674 1 88 . 1 . 1 5 5 C C2 C 13 160.263 0.002 . 1 . . . . A 5 C C2 . 34674 1 89 . 1 . 1 5 5 C C2' C 13 75.918 0.031 . 1 . . . . A 5 C C2' . 34674 1 90 . 1 . 1 5 5 C C3' C 13 77.001 0.104 . 1 . . . . A 5 C C3' . 34674 1 91 . 1 . 1 5 5 C C4' C 13 84.666 0.057 . 1 . . . . A 5 C C4' . 34674 1 92 . 1 . 1 5 5 C C5 C 13 99.379 0.059 . 1 . . . . A 5 C C5 . 34674 1 93 . 1 . 1 5 5 C C5' C 13 67.541 0.056 . 1 . . . . A 5 C C5' . 34674 1 94 . 1 . 1 5 5 C C6 C 13 143.632 0.016 . 1 . . . . A 5 C C6 . 34674 1 95 . 1 . 1 5 5 C N1 N 15 150.624 0.048 . 1 . . . . A 5 C N1 . 34674 1 96 . 1 . 1 6 6 A H1' H 1 6.102 0.001 . 1 . . . . A 6 A H1' . 34674 1 97 . 1 . 1 6 6 A H2 H 1 8.260 0.000 . 1 . . . . A 6 A H2 . 34674 1 98 . 1 . 1 6 6 A H2' H 1 4.821 0.001 . 1 . . . . A 6 A H2' . 34674 1 99 . 1 . 1 6 6 A H3' H 1 4.816 0.000 . 1 . . . . A 6 A H3' . 34674 1 100 . 1 . 1 6 6 A H4' H 1 4.601 0.001 . 1 . . . . A 6 A H4' . 34674 1 101 . 1 . 1 6 6 A H5' H 1 4.268 0.000 . 1 . . . . A 6 A H5' . 34674 1 102 . 1 . 1 6 6 A H5'' H 1 4.200 0.001 . 1 . . . . A 6 A H5'' . 34674 1 103 . 1 . 1 6 6 A H8 H 1 8.466 0.000 . 1 . . . . A 6 A H8 . 34674 1 104 . 1 . 1 6 6 A C1' C 13 90.113 0.012 . 1 . . . . A 6 A C1' . 34674 1 105 . 1 . 1 6 6 A C2 C 13 155.671 0.049 . 1 . . . . A 6 A C2 . 34674 1 106 . 1 . 1 6 6 A C2' C 13 76.072 0.029 . 1 . . . . A 6 A C2' . 34674 1 107 . 1 . 1 6 6 A C3' C 13 76.869 0.025 . 1 . . . . A 6 A C3' . 34674 1 108 . 1 . 1 6 6 A C4 C 13 151.524 0.014 . 1 . . . . A 6 A C4 . 34674 1 109 . 1 . 1 6 6 A C4' C 13 85.340 0.019 . 1 . . . . A 6 A C4' . 34674 1 110 . 1 . 1 6 6 A C5 C 13 121.448 0 . 1 . . . . A 6 A C5 . 34674 1 111 . 1 . 1 6 6 A C5' C 13 67.661 0.006 . 1 . . . . A 6 A C5' . 34674 1 112 . 1 . 1 6 6 A C6 C 13 158.275 0 . 1 . . . . A 6 A C6 . 34674 1 113 . 1 . 1 6 6 A C8 C 13 142.110 0.017 . 1 . . . . A 6 A C8 . 34674 1 114 . 1 . 1 6 6 A N1 N 15 216.803 0 . 1 . . . . A 6 A N1 . 34674 1 115 . 1 . 1 6 6 A N3 N 15 225.134 0 . 1 . . . . A 6 A N3 . 34674 1 116 . 1 . 1 6 6 A N7 N 15 232.511 0 . 1 . . . . A 6 A N7 . 34674 1 117 . 1 . 1 6 6 A N9 N 15 168.802 0.056 . 1 . . . . A 6 A N9 . 34674 1 118 . 1 . 1 7 7 U H1' H 1 6.026 0.001 . 1 . . . . A 7 U H1' . 34674 1 119 . 1 . 1 7 7 U H2' H 1 4.450 0.002 . 1 . . . . A 7 U H2' . 34674 1 120 . 1 . 1 7 7 U H3' H 1 4.694 0.001 . 1 . . . . A 7 U H3' . 34674 1 121 . 1 . 1 7 7 U H4' H 1 4.464 0.001 . 1 . . . . A 7 U H4' . 34674 1 122 . 1 . 1 7 7 U H5 H 1 5.782 0.002 . 1 . . . . A 7 U H5 . 34674 1 123 . 1 . 1 7 7 U H5' H 1 4.293 0.001 . 1 . . . . A 7 U H5' . 34674 1 124 . 1 . 1 7 7 U H5'' H 1 4.201 0.001 . 1 . . . . A 7 U H5'' . 34674 1 125 . 1 . 1 7 7 U H6 H 1 7.857 0.001 . 1 . . . . A 7 U H6 . 34674 1 126 . 1 . 1 7 7 U C1' C 13 90.727 0.012 . 1 . . . . A 7 U C1' . 34674 1 127 . 1 . 1 7 7 U C2 C 13 154.372 0.009 . 1 . . . . A 7 U C2 . 34674 1 128 . 1 . 1 7 7 U C2' C 13 75.662 0.030 . 1 . . . . A 7 U C2' . 34674 1 129 . 1 . 1 7 7 U C3' C 13 76.986 0.040 . 1 . . . . A 7 U C3' . 34674 1 130 . 1 . 1 7 7 U C4' C 13 85.422 0.019 . 1 . . . . A 7 U C4' . 34674 1 131 . 1 . 1 7 7 U C5 C 13 105.343 0.040 . 1 . . . . A 7 U C5 . 34674 1 132 . 1 . 1 7 7 U C5' C 13 67.843 0.060 . 1 . . . . A 7 U C5' . 34674 1 133 . 1 . 1 7 7 U C6 C 13 143.895 0.082 . 1 . . . . A 7 U C6 . 34674 1 134 . 1 . 1 7 7 U N1 N 15 144.087 0 . 1 . . . . A 7 U N1 . 34674 1 135 . 1 . 1 7 7 U N3 N 15 157.538 0 . 1 . . . . A 7 U N3 . 34674 1 136 . 1 . 1 8 8 U H1' H 1 5.993 0.000 . 1 . . . . A 8 U H1' . 34674 1 137 . 1 . 1 8 8 U H2' H 1 4.507 0.001 . 1 . . . . A 8 U H2' . 34674 1 138 . 1 . 1 8 8 U H3' H 1 4.765 0.001 . 1 . . . . A 8 U H3' . 34674 1 139 . 1 . 1 8 8 U H4' H 1 4.481 0.002 . 1 . . . . A 8 U H4' . 34674 1 140 . 1 . 1 8 8 U H5 H 1 5.888 0.000 . 1 . . . . A 8 U H5 . 34674 1 141 . 1 . 1 8 8 U H5' H 1 4.272 0.000 . 1 . . . . A 8 U H5' . 34674 1 142 . 1 . 1 8 8 U H5'' H 1 4.209 0.002 . 1 . . . . A 8 U H5'' . 34674 1 143 . 1 . 1 8 8 U H6 H 1 7.870 0.001 . 1 . . . . A 8 U H6 . 34674 1 144 . 1 . 1 8 8 U C1' C 13 91.013 0.030 . 1 . . . . A 8 U C1' . 34674 1 145 . 1 . 1 8 8 U C2 C 13 154.422 0.005 . 1 . . . . A 8 U C2 . 34674 1 146 . 1 . 1 8 8 U C2' C 13 75.429 0.032 . 1 . . . . A 8 U C2' . 34674 1 147 . 1 . 1 8 8 U C3' C 13 76.929 0.003 . 1 . . . . A 8 U C3' . 34674 1 148 . 1 . 1 8 8 U C4' C 13 85.155 0.008 . 1 . . . . A 8 U C4' . 34674 1 149 . 1 . 1 8 8 U C5 C 13 105.416 0.034 . 1 . . . . A 8 U C5 . 34674 1 150 . 1 . 1 8 8 U C5' C 13 67.809 0.003 . 1 . . . . A 8 U C5' . 34674 1 151 . 1 . 1 8 8 U C6 C 13 144.084 0.031 . 1 . . . . A 8 U C6 . 34674 1 152 . 1 . 1 8 8 U N1 N 15 144.209 0 . 1 . . . . A 8 U N1 . 34674 1 153 . 1 . 1 8 8 U N3 N 15 157.571 0 . 1 . . . . A 8 U N3 . 34674 1 154 . 1 . 1 9 9 G H1 H 1 11.537 0.001 . 1 . . . . A 9 G H1 . 34674 1 155 . 1 . 1 9 9 G H1' H 1 5.824 0.001 . 1 . . . . A 9 G H1' . 34674 1 156 . 1 . 1 9 9 G H2' H 1 5.002 0.000 . 1 . . . . A 9 G H2' . 34674 1 157 . 1 . 1 9 9 G H3' H 1 4.793 0.001 . 1 . . . . A 9 G H3' . 34674 1 158 . 1 . 1 9 9 G H4' H 1 4.577 0.002 . 1 . . . . A 9 G H4' . 34674 1 159 . 1 . 1 9 9 G H5' H 1 4.281 0.001 . 1 . . . . A 9 G H5' . 34674 1 160 . 1 . 1 9 9 G H5'' H 1 4.273 0.001 . 1 . . . . A 9 G H5'' . 34674 1 161 . 1 . 1 9 9 G H8 H 1 8.134 0.001 . 1 . . . . A 9 G H8 . 34674 1 162 . 1 . 1 9 9 G C1' C 13 89.468 0.022 . 1 . . . . A 9 G C1' . 34674 1 163 . 1 . 1 9 9 G C2' C 13 74.937 0.004 . 1 . . . . A 9 G C2' . 34674 1 164 . 1 . 1 9 9 G C3' C 13 73.543 0.012 . 1 . . . . A 9 G C3' . 34674 1 165 . 1 . 1 9 9 G C4 C 13 154.333 0 . 1 . . . . A 9 G C4 . 34674 1 166 . 1 . 1 9 9 G C4' C 13 84.722 0.028 . 1 . . . . A 9 G C4' . 34674 1 167 . 1 . 1 9 9 G C5 C 13 118.368 0.000 . 1 . . . . A 9 G C5 . 34674 1 168 . 1 . 1 9 9 G C5' C 13 68.294 0.003 . 1 . . . . A 9 G C5' . 34674 1 169 . 1 . 1 9 9 G C8 C 13 138.603 0.036 . 1 . . . . A 9 G C8 . 34674 1 170 . 1 . 1 9 9 G N1 N 15 144.061 0 . 1 . . . . A 9 G N1 . 34674 1 171 . 1 . 1 9 9 G N2 N 15 81.017 0.006 . 1 . . . . A 9 G N2 . 34674 1 172 . 1 . 1 9 9 G N7 N 15 236.387 0 . 1 . . . . A 9 G N7 . 34674 1 173 . 1 . 1 9 9 G N9 N 15 166.444 0 . 1 . . . . A 9 G N9 . 34674 1 174 . 1 . 1 10 10 G H1 H 1 11.530 0.002 . 1 . . . . A 10 G H1 . 34674 1 175 . 1 . 1 10 10 G H1' H 1 5.963 0.001 . 1 . . . . A 10 G H1' . 34674 1 176 . 1 . 1 10 10 G H2' H 1 4.711 0.001 . 1 . . . . A 10 G H2' . 34674 1 177 . 1 . 1 10 10 G H3' H 1 4.740 0.000 . 1 . . . . A 10 G H3' . 34674 1 178 . 1 . 1 10 10 G H4' H 1 4.644 0.001 . 1 . . . . A 10 G H4' . 34674 1 179 . 1 . 1 10 10 G H5' H 1 4.514 0.001 . 1 . . . . A 10 G H5' . 34674 1 180 . 1 . 1 10 10 G H5'' H 1 4.444 0.001 . 1 . . . . A 10 G H5'' . 34674 1 181 . 1 . 1 10 10 G H8 H 1 7.983 0.001 . 1 . . . . A 10 G H8 . 34674 1 182 . 1 . 1 10 10 G H21 H 1 9.364 0 . 1 . . . . A 10 G H21 . 34674 1 183 . 1 . 1 10 10 G H22 H 1 6.883 0 . 1 . . . . A 10 G H22 . 34674 1 184 . 1 . 1 10 10 G C1' C 13 93.297 0.010 . 1 . . . . A 10 G C1' . 34674 1 185 . 1 . 1 10 10 G C2' C 13 74.732 0.001 . 1 . . . . A 10 G C2' . 34674 1 186 . 1 . 1 10 10 G C3' C 13 74.426 0.027 . 1 . . . . A 10 G C3' . 34674 1 187 . 1 . 1 10 10 G C4 C 13 153.763 0 . 1 . . . . A 10 G C4 . 34674 1 188 . 1 . 1 10 10 G C4' C 13 83.651 0.026 . 1 . . . . A 10 G C4' . 34674 1 189 . 1 . 1 10 10 G C5 C 13 117.852 0.014 . 1 . . . . A 10 G C5 . 34674 1 190 . 1 . 1 10 10 G C5' C 13 67.784 0.004 . 1 . . . . A 10 G C5' . 34674 1 191 . 1 . 1 10 10 G C8 C 13 138.288 0.014 . 1 . . . . A 10 G C8 . 34674 1 192 . 1 . 1 10 10 G N1 N 15 143.334 0 . 1 . . . . A 10 G N1 . 34674 1 193 . 1 . 1 10 10 G N2 N 15 82.826 0.022 . 1 . . . . A 10 G N2 . 34674 1 194 . 1 . 1 10 10 G N7 N 15 233.650 0 . 1 . . . . A 10 G N7 . 34674 1 195 . 1 . 1 10 10 G N9 N 15 167.688 0 . 1 . . . . A 10 G N9 . 34674 1 196 . 1 . 1 11 11 G H1 H 1 11.403 0.002 . 1 . . . . A 11 G H1 . 34674 1 197 . 1 . 1 11 11 G H1' H 1 6.208 0.001 . 1 . . . . A 11 G H1' . 34674 1 198 . 1 . 1 11 11 G H2' H 1 4.671 0.001 . 1 . . . . A 11 G H2' . 34674 1 199 . 1 . 1 11 11 G H3' H 1 4.810 0.001 . 1 . . . . A 11 G H3' . 34674 1 200 . 1 . 1 11 11 G H4' H 1 4.755 0.001 . 1 . . . . A 11 G H4' . 34674 1 201 . 1 . 1 11 11 G H5' H 1 4.101 0.000 . 1 . . . . A 11 G H5' . 34674 1 202 . 1 . 1 11 11 G H5'' H 1 4.774 0.000 . 1 . . . . A 11 G H5'' . 34674 1 203 . 1 . 1 11 11 G H8 H 1 7.932 0.001 . 1 . . . . A 11 G H8 . 34674 1 204 . 1 . 1 11 11 G C1' C 13 87.491 0.004 . 1 . . . . A 11 G C1' . 34674 1 205 . 1 . 1 11 11 G C2' C 13 77.495 0.006 . 1 . . . . A 11 G C2' . 34674 1 206 . 1 . 1 11 11 G C3' C 13 81.388 0.011 . 1 . . . . A 11 G C3' . 34674 1 207 . 1 . 1 11 11 G C4 C 13 155.468 0 . 1 . . . . A 11 G C4 . 34674 1 208 . 1 . 1 11 11 G C4' C 13 83.990 0.025 . 1 . . . . A 11 G C4' . 34674 1 209 . 1 . 1 11 11 G C5 C 13 116.945 0.002 . 1 . . . . A 11 G C5 . 34674 1 210 . 1 . 1 11 11 G C5' C 13 67.749 0.018 . 1 . . . . A 11 G C5' . 34674 1 211 . 1 . 1 11 11 G C8 C 13 138.093 0.007 . 1 . . . . A 11 G C8 . 34674 1 212 . 1 . 1 11 11 G N1 N 15 143.757 0 . 1 . . . . A 11 G N1 . 34674 1 213 . 1 . 1 11 11 G N2 N 15 82.489 0.023 . 1 . . . . A 11 G N2 . 34674 1 214 . 1 . 1 11 11 G N7 N 15 239.250 0 . 1 . . . . A 11 G N7 . 34674 1 215 . 1 . 1 11 11 G N9 N 15 165.897 0 . 1 . . . . A 11 G N9 . 34674 1 216 . 1 . 1 12 12 U H1' H 1 6.230 0.001 . 1 . . . . A 12 U H1' . 34674 1 217 . 1 . 1 12 12 U H2' H 1 4.501 0.000 . 1 . . . . A 12 U H2' . 34674 1 218 . 1 . 1 12 12 U H3' H 1 4.928 0.001 . 1 . . . . A 12 U H3' . 34674 1 219 . 1 . 1 12 12 U H4' H 1 4.753 0.000 . 1 . . . . A 12 U H4' . 34674 1 220 . 1 . 1 12 12 U H5 H 1 6.043 0.000 . 1 . . . . A 12 U H5 . 34674 1 221 . 1 . 1 12 12 U H5' H 1 4.398 0.000 . 1 . . . . A 12 U H5' . 34674 1 222 . 1 . 1 12 12 U H5'' H 1 4.353 0.002 . 1 . . . . A 12 U H5'' . 34674 1 223 . 1 . 1 12 12 U H6 H 1 7.986 0.001 . 1 . . . . A 12 U H6 . 34674 1 224 . 1 . 1 12 12 U C1' C 13 89.084 0.029 . 1 . . . . A 12 U C1' . 34674 1 225 . 1 . 1 12 12 U C2 C 13 154.916 0.014 . 1 . . . . A 12 U C2 . 34674 1 226 . 1 . 1 12 12 U C2' C 13 76.169 0.008 . 1 . . . . A 12 U C2' . 34674 1 227 . 1 . 1 12 12 U C3' C 13 79.412 0.021 . 1 . . . . A 12 U C3' . 34674 1 228 . 1 . 1 12 12 U C4' C 13 86.076 0.027 . 1 . . . . A 12 U C4' . 34674 1 229 . 1 . 1 12 12 U C5 C 13 105.947 0.044 . 1 . . . . A 12 U C5 . 34674 1 230 . 1 . 1 12 12 U C5' C 13 68.683 0.021 . 1 . . . . A 12 U C5' . 34674 1 231 . 1 . 1 12 12 U C6 C 13 143.793 0.040 . 1 . . . . A 12 U C6 . 34674 1 232 . 1 . 1 12 12 U N1 N 15 143.621 0 . 1 . . . . A 12 U N1 . 34674 1 233 . 1 . 1 12 12 U N3 N 15 157.630 0 . 1 . . . . A 12 U N3 . 34674 1 234 . 1 . 1 13 13 G H1 H 1 11.423 0.001 . 1 . . . . A 13 G H1 . 34674 1 235 . 1 . 1 13 13 G H1' H 1 5.771 0.001 . 1 . . . . A 13 G H1' . 34674 1 236 . 1 . 1 13 13 G H2' H 1 4.963 0.000 . 1 . . . . A 13 G H2' . 34674 1 237 . 1 . 1 13 13 G H3' H 1 4.681 0.001 . 1 . . . . A 13 G H3' . 34674 1 238 . 1 . 1 13 13 G H4' H 1 4.579 0.000 . 1 . . . . A 13 G H4' . 34674 1 239 . 1 . 1 13 13 G H5' H 1 4.430 0.001 . 1 . . . . A 13 G H5' . 34674 1 240 . 1 . 1 13 13 G H5'' H 1 4.354 0.002 . 1 . . . . A 13 G H5'' . 34674 1 241 . 1 . 1 13 13 G H8 H 1 7.843 0.000 . 1 . . . . A 13 G H8 . 34674 1 242 . 1 . 1 13 13 G C1' C 13 94.094 0.027 . 1 . . . . A 13 G C1' . 34674 1 243 . 1 . 1 13 13 G C2' C 13 75.342 0.013 . 1 . . . . A 13 G C2' . 34674 1 244 . 1 . 1 13 13 G C3' C 13 76.077 0.034 . 1 . . . . A 13 G C3' . 34674 1 245 . 1 . 1 13 13 G C4 C 13 153.149 0 . 1 . . . . A 13 G C4 . 34674 1 246 . 1 . 1 13 13 G C4' C 13 82.821 0.021 . 1 . . . . A 13 G C4' . 34674 1 247 . 1 . 1 13 13 G C5 C 13 119.251 0.001 . 1 . . . . A 13 G C5 . 34674 1 248 . 1 . 1 13 13 G C5' C 13 67.109 0.020 . 1 . . . . A 13 G C5' . 34674 1 249 . 1 . 1 13 13 G C8 C 13 137.679 0.015 . 1 . . . . A 13 G C8 . 34674 1 250 . 1 . 1 13 13 G N1 N 15 144.240 0 . 1 . . . . A 13 G N1 . 34674 1 251 . 1 . 1 13 13 G N2 N 15 80.380 0.008 . 1 . . . . A 13 G N2 . 34674 1 252 . 1 . 1 13 13 G N7 N 15 235.257 0 . 1 . . . . A 13 G N7 . 34674 1 253 . 1 . 1 13 13 G N9 N 15 168.545 0 . 1 . . . . A 13 G N9 . 34674 1 254 . 1 . 1 14 14 G H1 H 1 11.600 0.001 . 1 . . . . A 14 G H1 . 34674 1 255 . 1 . 1 14 14 G H1' H 1 5.922 0.001 . 1 . . . . A 14 G H1' . 34674 1 256 . 1 . 1 14 14 G H2' H 1 4.437 0.000 . 1 . . . . A 14 G H2' . 34674 1 257 . 1 . 1 14 14 G H3' H 1 4.831 0.001 . 1 . . . . A 14 G H3' . 34674 1 258 . 1 . 1 14 14 G H4' H 1 4.546 0.002 . 1 . . . . A 14 G H4' . 34674 1 259 . 1 . 1 14 14 G H5' H 1 4.651 0.000 . 1 . . . . A 14 G H5' . 34674 1 260 . 1 . 1 14 14 G H5'' H 1 4.232 0.000 . 1 . . . . A 14 G H5'' . 34674 1 261 . 1 . 1 14 14 G H8 H 1 7.904 0.000 . 1 . . . . A 14 G H8 . 34674 1 262 . 1 . 1 14 14 G H21 H 1 9.567 0 . 1 . . . . A 14 G H21 . 34674 1 263 . 1 . 1 14 14 G H22 H 1 6.050 0 . 1 . . . . A 14 G H22 . 34674 1 264 . 1 . 1 14 14 G C1' C 13 92.888 0.015 . 1 . . . . A 14 G C1' . 34674 1 265 . 1 . 1 14 14 G C2' C 13 75.279 0.008 . 1 . . . . A 14 G C2' . 34674 1 266 . 1 . 1 14 14 G C3' C 13 73.133 0.024 . 1 . . . . A 14 G C3' . 34674 1 267 . 1 . 1 14 14 G C4 C 13 153.771 0 . 1 . . . . A 14 G C4 . 34674 1 268 . 1 . 1 14 14 G C4' C 13 82.537 0.013 . 1 . . . . A 14 G C4' . 34674 1 269 . 1 . 1 14 14 G C5 C 13 117.903 0.010 . 1 . . . . A 14 G C5 . 34674 1 270 . 1 . 1 14 14 G C5' C 13 64.983 0.014 . 1 . . . . A 14 G C5' . 34674 1 271 . 1 . 1 14 14 G C8 C 13 137.562 0.008 . 1 . . . . A 14 G C8 . 34674 1 272 . 1 . 1 14 14 G N1 N 15 143.691 0 . 1 . . . . A 14 G N1 . 34674 1 273 . 1 . 1 14 14 G N2 N 15 81.870 0.010 . 1 . . . . A 14 G N2 . 34674 1 274 . 1 . 1 14 14 G N7 N 15 234.299 0 . 1 . . . . A 14 G N7 . 34674 1 275 . 1 . 1 14 14 G N9 N 15 169.573 0 . 1 . . . . A 14 G N9 . 34674 1 276 . 1 . 1 15 15 G H1 H 1 11.340 0.001 . 1 . . . . A 15 G H1 . 34674 1 277 . 1 . 1 15 15 G H1' H 1 6.014 0.001 . 1 . . . . A 15 G H1' . 34674 1 278 . 1 . 1 15 15 G H2' H 1 4.318 0.001 . 1 . . . . A 15 G H2' . 34674 1 279 . 1 . 1 15 15 G H3' H 1 4.756 0.001 . 1 . . . . A 15 G H3' . 34674 1 280 . 1 . 1 15 15 G H4' H 1 4.285 0.002 . 1 . . . . A 15 G H4' . 34674 1 281 . 1 . 1 15 15 G H5' H 1 4.372 0.001 . 1 . . . . A 15 G H5' . 34674 1 282 . 1 . 1 15 15 G H5'' H 1 3.976 0.002 . 1 . . . . A 15 G H5'' . 34674 1 283 . 1 . 1 15 15 G H8 H 1 7.904 0.001 . 1 . . . . A 15 G H8 . 34674 1 284 . 1 . 1 15 15 G C1' C 13 90.394 0.012 . 1 . . . . A 15 G C1' . 34674 1 285 . 1 . 1 15 15 G C2' C 13 77.763 0.036 . 1 . . . . A 15 G C2' . 34674 1 286 . 1 . 1 15 15 G C3' C 13 76.619 0.056 . 1 . . . . A 15 G C3' . 34674 1 287 . 1 . 1 15 15 G C4 C 13 154.217 0 . 1 . . . . A 15 G C4 . 34674 1 288 . 1 . 1 15 15 G C4' C 13 84.552 0.059 . 1 . . . . A 15 G C4' . 34674 1 289 . 1 . 1 15 15 G C5 C 13 117.239 0.001 . 1 . . . . A 15 G C5 . 34674 1 290 . 1 . 1 15 15 G C5' C 13 66.388 0.041 . 1 . . . . A 15 G C5' . 34674 1 291 . 1 . 1 15 15 G C8 C 13 137.875 0.009 . 1 . . . . A 15 G C8 . 34674 1 292 . 1 . 1 15 15 G N1 N 15 143.653 0 . 1 . . . . A 15 G N1 . 34674 1 293 . 1 . 1 15 15 G N2 N 15 82.388 0.002 . 1 . . . . A 15 G N2 . 34674 1 294 . 1 . 1 15 15 G N7 N 15 236.314 0 . 1 . . . . A 15 G N7 . 34674 1 295 . 1 . 1 15 15 G N9 N 15 171.174 0 . 1 . . . . A 15 G N9 . 34674 1 296 . 1 . 1 16 16 A H1' H 1 6.094 0.001 . 1 . . . . A 16 A H1' . 34674 1 297 . 1 . 1 16 16 A H2 H 1 8.124 0.001 . 1 . . . . A 16 A H2 . 34674 1 298 . 1 . 1 16 16 A H2' H 1 4.837 0.001 . 1 . . . . A 16 A H2' . 34674 1 299 . 1 . 1 16 16 A H3' H 1 4.793 0.001 . 1 . . . . A 16 A H3' . 34674 1 300 . 1 . 1 16 16 A H4' H 1 4.567 0.002 . 1 . . . . A 16 A H4' . 34674 1 301 . 1 . 1 16 16 A H5' H 1 4.321 0.001 . 1 . . . . A 16 A H5' . 34674 1 302 . 1 . 1 16 16 A H5'' H 1 4.150 0.000 . 1 . . . . A 16 A H5'' . 34674 1 303 . 1 . 1 16 16 A H8 H 1 8.437 0.001 . 1 . . . . A 16 A H8 . 34674 1 304 . 1 . 1 16 16 A C1' C 13 89.024 0.021 . 1 . . . . A 16 A C1' . 34674 1 305 . 1 . 1 16 16 A C2 C 13 155.579 0.035 . 1 . . . . A 16 A C2 . 34674 1 306 . 1 . 1 16 16 A C2' C 13 76.050 0.092 . 1 . . . . A 16 A C2' . 34674 1 307 . 1 . 1 16 16 A C3' C 13 77.637 0.003 . 1 . . . . A 16 A C3' . 34674 1 308 . 1 . 1 16 16 A C4 C 13 151.832 0.007 . 1 . . . . A 16 A C4 . 34674 1 309 . 1 . 1 16 16 A C4' C 13 85.831 0.002 . 1 . . . . A 16 A C4' . 34674 1 310 . 1 . 1 16 16 A C5 C 13 121.769 0.001 . 1 . . . . A 16 A C5 . 34674 1 311 . 1 . 1 16 16 A C5' C 13 68.405 0.013 . 1 . . . . A 16 A C5' . 34674 1 312 . 1 . 1 16 16 A C6 C 13 158.243 0 . 1 . . . . A 16 A C6 . 34674 1 313 . 1 . 1 16 16 A C8 C 13 142.267 0.006 . 1 . . . . A 16 A C8 . 34674 1 314 . 1 . 1 16 16 A N1 N 15 217.210 0 . 1 . . . . A 16 A N1 . 34674 1 315 . 1 . 1 16 16 A N3 N 15 224.585 0 . 1 . . . . A 16 A N3 . 34674 1 316 . 1 . 1 16 16 A N7 N 15 233.374 0 . 1 . . . . A 16 A N7 . 34674 1 317 . 1 . 1 16 16 A N9 N 15 167.810 0.028 . 1 . . . . A 16 A N9 . 34674 1 318 . 1 . 1 17 17 U H1' H 1 6.054 0.000 . 1 . . . . A 17 U H1' . 34674 1 319 . 1 . 1 17 17 U H2' H 1 4.489 0.001 . 1 . . . . A 17 U H2' . 34674 1 320 . 1 . 1 17 17 U H3' H 1 4.686 0.002 . 1 . . . . A 17 U H3' . 34674 1 321 . 1 . 1 17 17 U H4' H 1 4.518 0.001 . 1 . . . . A 17 U H4' . 34674 1 322 . 1 . 1 17 17 U H5 H 1 5.944 0.000 . 1 . . . . A 17 U H5 . 34674 1 323 . 1 . 1 17 17 U H5' H 1 4.276 0.001 . 1 . . . . A 17 U H5' . 34674 1 324 . 1 . 1 17 17 U H5'' H 1 4.215 0.001 . 1 . . . . A 17 U H5'' . 34674 1 325 . 1 . 1 17 17 U H6 H 1 7.946 0.001 . 1 . . . . A 17 U H6 . 34674 1 326 . 1 . 1 17 17 U C1' C 13 90.930 0.046 . 1 . . . . A 17 U C1' . 34674 1 327 . 1 . 1 17 17 U C2 C 13 154.466 0.001 . 1 . . . . A 17 U C2 . 34674 1 328 . 1 . 1 17 17 U C2' C 13 75.498 0.033 . 1 . . . . A 17 U C2' . 34674 1 329 . 1 . 1 17 17 U C3' C 13 76.890 0.022 . 1 . . . . A 17 U C3' . 34674 1 330 . 1 . 1 17 17 U C4' C 13 85.347 0.025 . 1 . . . . A 17 U C4' . 34674 1 331 . 1 . 1 17 17 U C5 C 13 105.463 0.037 . 1 . . . . A 17 U C5 . 34674 1 332 . 1 . 1 17 17 U C5' C 13 67.870 0.004 . 1 . . . . A 17 U C5' . 34674 1 333 . 1 . 1 17 17 U C6 C 13 144.183 0.034 . 1 . . . . A 17 U C6 . 34674 1 334 . 1 . 1 17 17 U N1 N 15 144.208 0 . 1 . . . . A 17 U N1 . 34674 1 335 . 1 . 1 17 17 U N3 N 15 157.709 0 . 1 . . . . A 17 U N3 . 34674 1 336 . 1 . 1 18 18 C H1' H 1 5.950 0.001 . 1 . . . . A 18 C H1' . 34674 1 337 . 1 . 1 18 18 C H2' H 1 4.412 0.001 . 1 . . . . A 18 C H2' . 34674 1 338 . 1 . 1 18 18 C H3' H 1 4.630 0.001 . 1 . . . . A 18 C H3' . 34674 1 339 . 1 . 1 18 18 C H4' H 1 4.460 0.000 . 1 . . . . A 18 C H4' . 34674 1 340 . 1 . 1 18 18 C H5 H 1 6.035 0.001 . 1 . . . . A 18 C H5 . 34674 1 341 . 1 . 1 18 18 C H5' H 1 4.266 0.000 . 1 . . . . A 18 C H5' . 34674 1 342 . 1 . 1 18 18 C H5'' H 1 4.174 0.001 . 1 . . . . A 18 C H5'' . 34674 1 343 . 1 . 1 18 18 C H6 H 1 7.853 0.002 . 1 . . . . A 18 C H6 . 34674 1 344 . 1 . 1 18 18 C C1' C 13 91.744 0.017 . 1 . . . . A 18 C C1' . 34674 1 345 . 1 . 1 18 18 C C2 C 13 160.064 0 . 1 . . . . A 18 C C2 . 34674 1 346 . 1 . 1 18 18 C C2' C 13 75.749 0.028 . 1 . . . . A 18 C C2' . 34674 1 347 . 1 . 1 18 18 C C3' C 13 76.691 0.035 . 1 . . . . A 18 C C3' . 34674 1 348 . 1 . 1 18 18 C C4' C 13 84.779 0.001 . 1 . . . . A 18 C C4' . 34674 1 349 . 1 . 1 18 18 C C5 C 13 99.231 0.069 . 1 . . . . A 18 C C5 . 34674 1 350 . 1 . 1 18 18 C C5' C 13 67.691 0.001 . 1 . . . . A 18 C C5' . 34674 1 351 . 1 . 1 18 18 C C6 C 13 144.025 0.004 . 1 . . . . A 18 C C6 . 34674 1 352 . 1 . 1 18 18 C N1 N 15 151.030 0.037 . 1 . . . . A 18 C N1 . 34674 1 353 . 1 . 1 19 19 U H1' H 1 5.948 0.001 . 1 . . . . A 19 U H1' . 34674 1 354 . 1 . 1 19 19 U H2' H 1 4.496 0.001 . 1 . . . . A 19 U H2' . 34674 1 355 . 1 . 1 19 19 U H3' H 1 4.783 0.002 . 1 . . . . A 19 U H3' . 34674 1 356 . 1 . 1 19 19 U H4' H 1 4.489 0.002 . 1 . . . . A 19 U H4' . 34674 1 357 . 1 . 1 19 19 U H5 H 1 5.714 0.000 . 1 . . . . A 19 U H5 . 34674 1 358 . 1 . 1 19 19 U H5' H 1 4.278 0.000 . 1 . . . . A 19 U H5' . 34674 1 359 . 1 . 1 19 19 U H5'' H 1 4.183 0.001 . 1 . . . . A 19 U H5'' . 34674 1 360 . 1 . 1 19 19 U H6 H 1 7.825 0.002 . 1 . . . . A 19 U H6 . 34674 1 361 . 1 . 1 19 19 U C1' C 13 91.064 0.038 . 1 . . . . A 19 U C1' . 34674 1 362 . 1 . 1 19 19 U C2 C 13 154.312 0.011 . 1 . . . . A 19 U C2 . 34674 1 363 . 1 . 1 19 19 U C2' C 13 75.474 0.047 . 1 . . . . A 19 U C2' . 34674 1 364 . 1 . 1 19 19 U C3' C 13 76.839 0.039 . 1 . . . . A 19 U C3' . 34674 1 365 . 1 . 1 19 19 U C4' C 13 85.243 0.028 . 1 . . . . A 19 U C4' . 34674 1 366 . 1 . 1 19 19 U C5 C 13 105.071 0.037 . 1 . . . . A 19 U C5 . 34674 1 367 . 1 . 1 19 19 U C5' C 13 67.671 0.023 . 1 . . . . A 19 U C5' . 34674 1 368 . 1 . 1 19 19 U C6 C 13 143.850 0.042 . 1 . . . . A 19 U C6 . 34674 1 369 . 1 . 1 19 19 U N1 N 15 144.251 0 . 1 . . . . A 19 U N1 . 34674 1 370 . 1 . 1 19 19 U N3 N 15 157.584 0 . 1 . . . . A 19 U N3 . 34674 1 371 . 1 . 1 20 20 G H1 H 1 11.529 0.002 . 1 . . . . A 20 G H1 . 34674 1 372 . 1 . 1 20 20 G H1' H 1 5.824 0.000 . 1 . . . . A 20 G H1' . 34674 1 373 . 1 . 1 20 20 G H2' H 1 4.963 0.000 . 1 . . . . A 20 G H2' . 34674 1 374 . 1 . 1 20 20 G H3' H 1 4.748 0.002 . 1 . . . . A 20 G H3' . 34674 1 375 . 1 . 1 20 20 G H4' H 1 4.599 0.002 . 1 . . . . A 20 G H4' . 34674 1 376 . 1 . 1 20 20 G H5' H 1 4.341 0.002 . 1 . . . . A 20 G H5' . 34674 1 377 . 1 . 1 20 20 G H5'' H 1 4.290 0.001 . 1 . . . . A 20 G H5'' . 34674 1 378 . 1 . 1 20 20 G H8 H 1 8.082 0.001 . 1 . . . . A 20 G H8 . 34674 1 379 . 1 . 1 20 20 G C1' C 13 90.488 0.019 . 1 . . . . A 20 G C1' . 34674 1 380 . 1 . 1 20 20 G C2' C 13 75.169 0.017 . 1 . . . . A 20 G C2' . 34674 1 381 . 1 . 1 20 20 G C3' C 13 75.987 0.067 . 1 . . . . A 20 G C3' . 34674 1 382 . 1 . 1 20 20 G C4 C 13 154.199 0 . 1 . . . . A 20 G C4 . 34674 1 383 . 1 . 1 20 20 G C4' C 13 84.515 0.029 . 1 . . . . A 20 G C4' . 34674 1 384 . 1 . 1 20 20 G C5 C 13 118.582 0.004 . 1 . . . . A 20 G C5 . 34674 1 385 . 1 . 1 20 20 G C5' C 13 68.498 0.000 . 1 . . . . A 20 G C5' . 34674 1 386 . 1 . 1 20 20 G C8 C 13 138.421 0.007 . 1 . . . . A 20 G C8 . 34674 1 387 . 1 . 1 20 20 G N1 N 15 144.179 0 . 1 . . . . A 20 G N1 . 34674 1 388 . 1 . 1 20 20 G N2 N 15 80.415 0.014 . 1 . . . . A 20 G N2 . 34674 1 389 . 1 . 1 20 20 G N7 N 15 236.225 0 . 1 . . . . A 20 G N7 . 34674 1 390 . 1 . 1 20 20 G N9 N 15 166.720 0 . 1 . . . . A 20 G N9 . 34674 1 391 . 1 . 1 21 21 G H1 H 1 11.567 0.001 . 1 . . . . A 21 G H1 . 34674 1 392 . 1 . 1 21 21 G H1' H 1 6.033 0.001 . 1 . . . . A 21 G H1' . 34674 1 393 . 1 . 1 21 21 G H2' H 1 4.523 0.000 . 1 . . . . A 21 G H2' . 34674 1 394 . 1 . 1 21 21 G H3' H 1 4.813 0.002 . 1 . . . . A 21 G H3' . 34674 1 395 . 1 . 1 21 21 G H4' H 1 4.633 0.001 . 1 . . . . A 21 G H4' . 34674 1 396 . 1 . 1 21 21 G H5' H 1 4.562 0.000 . 1 . . . . A 21 G H5' . 34674 1 397 . 1 . 1 21 21 G H5'' H 1 4.476 0.001 . 1 . . . . A 21 G H5'' . 34674 1 398 . 1 . 1 21 21 G H8 H 1 7.979 0.001 . 1 . . . . A 21 G H8 . 34674 1 399 . 1 . 1 21 21 G H21 H 1 9.719 0 . 1 . . . . A 21 G H21 . 34674 1 400 . 1 . 1 21 21 G H22 H 1 5.952 0 . 1 . . . . A 21 G H22 . 34674 1 401 . 1 . 1 21 21 G C1' C 13 93.219 0.027 . 1 . . . . A 21 G C1' . 34674 1 402 . 1 . 1 21 21 G C2' C 13 75.256 0.003 . 1 . . . . A 21 G C2' . 34674 1 403 . 1 . 1 21 21 G C3' C 13 76.785 0.115 . 1 . . . . A 21 G C3' . 34674 1 404 . 1 . 1 21 21 G C4 C 13 153.656 0 . 1 . . . . A 21 G C4 . 34674 1 405 . 1 . 1 21 21 G C4' C 13 82.996 0.008 . 1 . . . . A 21 G C4' . 34674 1 406 . 1 . 1 21 21 G C5 C 13 117.995 0.011 . 1 . . . . A 21 G C5 . 34674 1 407 . 1 . 1 21 21 G C5' C 13 66.831 0.016 . 1 . . . . A 21 G C5' . 34674 1 408 . 1 . 1 21 21 G C8 C 13 138.086 0.012 . 1 . . . . A 21 G C8 . 34674 1 409 . 1 . 1 21 21 G N1 N 15 143.478 0 . 1 . . . . A 21 G N1 . 34674 1 410 . 1 . 1 21 21 G N2 N 15 81.999 0.003 . 1 . . . . A 21 G N2 . 34674 1 411 . 1 . 1 21 21 G N7 N 15 233.582 0 . 1 . . . . A 21 G N7 . 34674 1 412 . 1 . 1 21 21 G N9 N 15 168.993 0 . 1 . . . . A 21 G N9 . 34674 1 413 . 1 . 1 22 22 G H1 H 1 11.386 0.001 . 1 . . . . A 22 G H1 . 34674 1 414 . 1 . 1 22 22 G H1' H 1 6.130 0.001 . 1 . . . . A 22 G H1' . 34674 1 415 . 1 . 1 22 22 G H2' H 1 4.218 0.002 . 1 . . . . A 22 G H2' . 34674 1 416 . 1 . 1 22 22 G H3' H 1 4.479 0.001 . 1 . . . . A 22 G H3' . 34674 1 417 . 1 . 1 22 22 G H4' H 1 4.384 0.001 . 1 . . . . A 22 G H4' . 34674 1 418 . 1 . 1 22 22 G H5' H 1 4.654 0.002 . 1 . . . . A 22 G H5' . 34674 1 419 . 1 . 1 22 22 G H5'' H 1 4.155 0.000 . 1 . . . . A 22 G H5'' . 34674 1 420 . 1 . 1 22 22 G H8 H 1 7.865 0.000 . 1 . . . . A 22 G H8 . 34674 1 421 . 1 . 1 22 22 G C1' C 13 90.721 0.011 . 1 . . . . A 22 G C1' . 34674 1 422 . 1 . 1 22 22 G C2' C 13 78.306 0.024 . 1 . . . . A 22 G C2' . 34674 1 423 . 1 . 1 22 22 G C3' C 13 71.083 0.001 . 1 . . . . A 22 G C3' . 34674 1 424 . 1 . 1 22 22 G C4 C 13 154.029 0 . 1 . . . . A 22 G C4 . 34674 1 425 . 1 . 1 22 22 G C4' C 13 84.496 0.011 . 1 . . . . A 22 G C4' . 34674 1 426 . 1 . 1 22 22 G C5 C 13 117.450 0.005 . 1 . . . . A 22 G C5 . 34674 1 427 . 1 . 1 22 22 G C5' C 13 65.910 0.014 . 1 . . . . A 22 G C5' . 34674 1 428 . 1 . 1 22 22 G C8 C 13 137.581 0.027 . 1 . . . . A 22 G C8 . 34674 1 429 . 1 . 1 22 22 G N1 N 15 143.576 0 . 1 . . . . A 22 G N1 . 34674 1 430 . 1 . 1 22 22 G N2 N 15 82.245 0.001 . 1 . . . . A 22 G N2 . 34674 1 431 . 1 . 1 22 22 G N7 N 15 236.738 0 . 1 . . . . A 22 G N7 . 34674 1 432 . 1 . 1 22 22 G N9 N 15 171.142 0 . 1 . . . . A 22 G N9 . 34674 1 stop_ save_ ######################### # Spectral peak lists # ######################### save_spectral_peak_list_1 _Spectral_peak_list.Sf_category spectral_peak_list _Spectral_peak_list.Sf_framecode spectral_peak_list_1 _Spectral_peak_list.Entry_ID 34674 _Spectral_peak_list.ID 1 _Spectral_peak_list.Name . _Spectral_peak_list.Sample_ID 1 _Spectral_peak_list.Sample_label $sample_1 _Spectral_peak_list.Sample_condition_list_ID 1 _Spectral_peak_list.Sample_condition_list_label $sample_conditions_1 _Spectral_peak_list.Chem_shift_reference_ID 1 _Spectral_peak_list.Chem_shift_reference_label $chem_shift_reference_1 _Spectral_peak_list.Experiment_ID 1 _Spectral_peak_list.Experiment_name '2D 1H-1H NOESY' _Spectral_peak_list.Experiment_class . _Spectral_peak_list.Experiment_type . _Spectral_peak_list.Number_of_spectral_dimensions 2 _Spectral_peak_list.Chemical_shift_list . _Spectral_peak_list.Assigned_chem_shift_list_ID 1 _Spectral_peak_list.Assigned_chem_shift_list_label $assigned_chemical_shifts_1 _Spectral_peak_list.Details . _Spectral_peak_list.Text_data_format text _Spectral_peak_list.Text_data ; 295 peaks Assignment Shift (ppm) G1H1-H1 11.566 11.567 G1H1-G2H1 11.566 11.694 G1H1'-H1 5.825 11.564 G1H1'-H1' 5.824 5.826 G1H1'-H8 5.825 8.131 G1H1'-G2H8 5.827 8.021 G1H1'-G21H1 5.825 11.568 G1H2'-H1 4.986 11.564 G1H2'-H8 4.976 8.133 G1H2'-G2H8 4.976 8.022 G1H2'-G21H1 4.973 11.568 G1H3'-G21H1 4.795 11.571 G1H4'-H8 4.636 8.130 G1H5"-H8 4.347 8.130 G1H5'-H8 4.348 8.129 G1H8-H8 8.130 8.132 G1H8-G20H1 8.133 11.527 G1H8-G21H1 8.125 11.567 G2H1-H1 11.693 11.694 G2H1'-G1H1 6.014 11.566 G2H1'-H1 6.010 11.694 G2H1'-H1' 6.013 6.012 G2H1'-H8 6.011 8.021 G2H1'-G3H8 6.009 7.898 G2H1'-G9H8 6.011 8.128 G2H1'-G22H1 6.011 11.384 G2H2'-H1 4.500 11.694 G2H2'-H8 4.503 8.021 G2H2'-G3H8 4.500 7.899 G2H2'-G22H1 4.501 11.385 G2H21-H1 9.844 11.695 G2H22-H1 5.933 11.695 G2H4'-H8 4.648 8.022 G2H5"-H8 4.553 8.021 G2H8-H8 8.021 8.020 G2H8-G21H1 8.022 11.567 G2H8-G22H1 8.023 11.385 G3H1-G2H1 11.561 11.694 G3H1-H1 11.557 11.563 G3H1'-G2H1 6.110 11.694 G3H1'-H1 6.108 11.564 G3H1'-H1' 6.110 6.110 G3H1'-H8 6.111 7.898 G3H1'-A6H2 6.110 8.253 G3H2'-H1 4.290 11.565 G3H2'-H8 4.291 7.899 G3H2'-C4H6 4.290 7.653 G3H2'-A6H2 4.289 8.253 G3H3'-H8 4.802 7.898 G3H5"-H8 4.148 7.900 G3H8-G2H1 7.895 11.693 G3H8-H8 7.900 7.899 G3H8-G22H1 7.898 11.386 C4H1'-H1' 5.776 5.777 C4H1'-H6 5.778 7.650 C4H1'-A6H2 5.779 8.253 C4H2'-H6 4.191 7.651 C4H3'-H6 4.506 7.652 C4H4'-A6H8 4.099 8.460 C4H5-H5 5.812 5.813 C4H5-H6 5.812 7.649 C4H5-G22H1 5.815 11.385 C4H5"-H6 4.016 7.651 C4H6-H6 7.653 7.652 C5H1'-H1' 5.954 5.953 C5H1'-H6 5.956 7.789 C5H2'-H6 4.310 7.790 C5H2'-A6H8 4.307 8.459 C5H3'-H6 4.539 7.790 C5H3'-A6H8 4.540 8.460 C5H5-H5 6.001 6.001 C5H5-H6 6.003 7.789 C5H5"-H6 4.035 7.791 C5H5"-A6H8 4.032 8.459 C5H5'-H6 4.097 7.789 C5H6-H6 7.791 7.790 C5H6-A6H8 7.790 8.460 A6H1'-H1' 6.093 6.094 A6H1'-H2 6.094 8.253 A6H1'-H8 6.093 8.460 A6H1'-U7H6 6.094 7.852 A6H2-H2 8.253 8.252 A6H2'-H8 4.807 8.459 A6H3'-H8 4.800 8.458 A6H5"-H8 4.194 8.459 A6H5'-H8 4.258 8.459 A6H8-H8 8.461 8.460 U7H1'-A6H2 6.009 8.253 U7H1'-H1' 6.006 6.006 U7H1'-H6 6.005 7.851 U7H2'-H6 4.454 7.852 U7H3'-H6 4.681 7.852 U7H5-A6H8 5.783 8.459 U7H5-H5 5.784 5.785 U7H5-H6 5.783 7.852 U7H6-H6 7.850 7.852 U8H1'-H1' 5.985 5.985 U8H1'-H6 5.986 7.853 U8H2'-H6 4.504 7.856 U8H5-G1H1 5.887 11.565 U8H5-H5 5.885 5.883 U8H5-H6 5.885 7.851 U8H6-G1H1 7.850 11.565 U8H6-H6 7.852 7.855 G9H1-H1 11.539 11.537 G9H1'-G2H1 5.816 11.694 G9H1'-H1 5.815 11.536 G9H1'-H1' 5.813 5.814 G9H1'-H8 5.818 8.128 G9H1'-G10H8 5.816 7.978 G9H2'-G2H1 4.993 11.694 G9H2'-H1 4.988 11.538 G9H2'-H8 4.990 8.127 G9H2'-G10H8 4.991 7.979 G9H5"-H8 4.268 8.126 G9H5'-H8 4.268 8.127 G9H8-G1H1 8.129 11.565 G9H8-G2H1 8.129 11.695 G9H8-H8 8.128 8.128 G10H1-G2H1 11.531 11.694 G10H1-H1 11.535 11.529 G10H1'-G3H1 5.954 11.564 G10H1'-G9H1 5.955 11.537 G10H1'-H1 5.955 11.530 G10H1'-H1' 5.956 5.955 G10H1'-H8 5.954 7.978 G10H1'-G11H8 5.950 7.923 G10H2'-H1 4.690 11.529 G10H2'-G11H8 4.694 7.923 G10H21-H1 9.364 11.529 G10H22-H1 6.883 11.529 G10H8-G2H1 7.980 11.695 G10H8-G3H1 7.980 11.564 G10H8-G9H1 7.981 11.536 G10H8-H8 7.977 7.978 G11H1-G3H1 11.407 11.565 G11H1-G10H1 11.405 11.529 G11H1-H1 11.406 11.403 G11H1-G14H1 11.407 11.600 G11H1'-G10H1 6.196 11.530 G11H1'-H1 6.194 11.401 G11H1'-H1' 6.192 6.191 G11H1'-H8 6.194 7.922 G11H2'-H8 4.662 7.923 G11H5"-H8 4.096 7.922 G11H5'-H8 4.799 7.923 G11H8-G3H1 7.922 11.564 G11H8-H8 7.923 7.922 U12H1'-H1' 6.219 6.219 U12H1'-H6 6.219 7.972 U12H2'-H6 4.495 7.973 U12H5-H5 6.040 6.039 U12H5-H6 6.042 7.972 U12H6-H6 7.972 7.972 G13H1-G9H1 11.423 11.538 G13H1-H1 11.421 11.422 G13H1-G14H1 11.423 11.601 G13H1-G20H1 11.422 11.530 G13H1'-G10H1 5.765 11.534 G13H1'-H1 5.763 11.423 G13H1'-H1' 5.767 5.767 G13H1'-H8 5.767 7.838 G13H1'-G14H8 5.765 7.894 G13H2'-G10H1 4.957 11.529 G13H2'-H1 4.955 11.422 G13H2'-H8 4.956 7.838 G13H2'-G14H8 4.956 7.893 G13H3'-G10H1 4.664 11.529 G13H3'-H8 4.670 7.837 G13H5"-H8 4.345 7.838 G13H5'-H8 4.439 7.838 G13H8-G9H1 7.840 11.537 G13H8-G10H1 7.841 11.529 G13H8-H8 7.837 7.839 G14H1-G11H1 11.597 11.402 G14H1-H1 11.599 11.600 G14H1-G15H1 11.599 11.340 G14H1'-G13H1 5.914 11.423 G14H1'-H1 5.917 11.600 G14H1'-H1' 5.915 5.914 G14H1'-H8 5.911 7.895 G14H1'-G15H8 5.912 7.893 G14H1'-G20H8 5.915 8.082 G14H2'-G11H1 4.428 11.401 G14H2'-H8 4.431 7.892 G14H2'-G15H8 4.429 7.893 G14H21-H1 9.567 11.600 G14H22-H1 6.050 11.600 G14H3'-G11H1 4.800 11.403 G14H5"-H8 4.226 7.891 G14H8-G10H1 7.894 11.529 G14H8-G11H1 7.895 11.401 G14H8-G13H1 7.894 11.424 G14H8-H8 7.895 7.895 G15H1-G14H1 11.339 11.599 G15H1-H1 11.340 11.339 G15H1-G21H1 11.339 11.565 G15H1'-G14H1 6.002 11.601 G15H1'-H1 6.002 11.340 G15H1'-H1' 6.007 6.008 G15H1'-H8 6.005 7.894 G15H2'-H8 4.316 7.893 G15H3'-H8 4.812 7.893 G15H4'-H8 4.280 7.893 G15H4'-A16H8 4.281 8.437 G15H5"-H8 3.959 7.893 G15H5"-A16H8 3.958 8.437 G15H8-G11H1 7.894 11.401 G15H8-G14H1 7.893 11.600 G15H8-H1 7.893 11.341 G15H8-H8 7.895 7.894 A16H1'-H1' 6.086 6.087 A16H1'-H2 6.086 8.124 A16H1'-H8 6.086 8.436 A16H2-G15H1 8.125 11.341 A16H2-H2 8.122 8.123 A16H2'-H8 4.827 8.437 A16H3'-H8 4.770 8.438 A16H4'-H8 4.562 8.438 A16H5"-H8 4.140 8.437 A16H5'-H8 4.315 8.437 A16H8-H8 8.438 8.437 U17H1'-H1' 6.040 6.039 U17H1'-H6 6.042 7.937 U17H2'-H6 4.483 7.931 U17H5-H5 5.940 5.938 U17H5-H6 5.938 7.936 U17H5"-H6 4.205 7.932 U17H5'-H6 4.272 7.931 U17H6-H6 7.935 7.936 C18H1'-H1' 5.944 5.944 C18H1'-H6 5.947 7.842 C18H2'-H6 4.410 7.841 C18H5-H5 6.031 6.031 C18H5-H6 6.031 7.841 C18H5"-H6 4.171 7.840 C18H6-H6 7.840 7.841 U19H1'-A16H8 5.941 8.437 U19H1'-H1' 5.939 5.939 U19H1'-H6 5.938 7.809 U19H1'-G20H8 5.937 8.081 U19H2'-H6 4.490 7.810 U19H2'-G20H8 4.488 8.081 U19H5-A16H8 5.711 8.438 U19H5-H5 5.709 5.712 U19H5-H6 5.710 7.809 U19H5"-H6 4.173 7.810 U19H5'-H6 4.270 7.812 U19H6-A16H8 7.814 8.439 U19H6-H6 7.810 7.810 G20H1-H1 11.535 11.530 G20H1'-H1 5.816 11.528 G20H1'-H1' 5.815 5.816 G20H1'-H8 5.815 8.081 G20H1'-G21H8 5.816 7.978 G20H2'-G14H1 4.957 11.599 G20H2'-H8 4.955 8.081 G20H2'-G21H8 4.955 7.976 G20H3'-G14H1 4.738 11.599 G20H4'-H8 4.592 8.081 G20H5"-H8 4.282 8.080 G20H5'-H8 4.331 8.081 G20H8-G13H1 8.081 11.423 G20H8-G14H1 8.081 11.601 G20H8-H1 8.079 11.525 G20H8-H8 8.081 8.080 G21H1-H1 11.565 11.567 G21H1'-G1H8 6.020 8.131 G21H1'-G15H1 6.022 11.340 G21H1'-G20H1 6.022 11.528 G21H1'-H1 6.019 11.568 G21H1'-H1' 6.016 6.017 G21H1'-H8 6.019 7.979 G21H1'-G22H8 6.018 7.854 G21H2"-H1 4.512 11.567 G21H2'-G15H1 4.518 11.339 G21H21-H1 9.719 11.569 G21H22-H1 5.952 11.566 G21H5'-H8 4.539 7.976 G21H8-G14H1 7.977 11.600 G21H8-G15H1 7.976 11.340 G21H8-G20H1 7.979 11.528 G21H8-H8 7.978 7.977 G22H1-G2H1 11.386 11.694 G22H1-G21H1 11.388 11.567 G22H1-H1 11.386 11.385 G22H1'-G21H1 6.112 11.567 G22H1'-H1 6.114 11.385 G22H1'-H1' 6.112 6.112 G22H1'-H8 6.116 7.854 G22H2'-H1 4.214 11.387 G22H2'-H8 4.214 7.854 G22H8-G15H1 7.856 11.340 G22H8-G21H1 7.856 11.567 G22H8-H8 7.850 7.855 ; loop_ _Spectral_dim.ID _Spectral_dim.Axis_code _Spectral_dim.Spectrometer_frequency _Spectral_dim.Atom_type _Spectral_dim.Atom_isotope_number _Spectral_dim.Spectral_region _Spectral_dim.Magnetization_linkage_ID _Spectral_dim.Under_sampling_type _Spectral_dim.Sweep_width _Spectral_dim.Sweep_width_units _Spectral_dim.Value_first_point _Spectral_dim.Absolute_peak_positions _Spectral_dim.Acquisition _Spectral_dim.Center_frequency_offset _Spectral_dim.Encoding_code _Spectral_dim.Encoded_reduced_dimension_ID _Spectral_dim.Entry_ID _Spectral_dim.Spectral_peak_list_ID 1 . . H 1 H . . 8196.753 Hz . . . 6301.26 . . 34674 1 2 . . H 1 H . . 8196.753 Hz . . . 6301.26 . . 34674 1 stop_ loop_ _Spectral_peak_software.Software_ID _Spectral_peak_software.Software_label _Spectral_peak_software.Method_ID _Spectral_peak_software.Method_label _Spectral_peak_software.Entry_ID _Spectral_peak_software.Spectral_peak_list_ID 2 $software_2 . . 34674 1 stop_ save_