data_34676 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34676 _Entry.Title ; Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-11-08 _Entry.Accession_date 2021-11-08 _Entry.Last_release_date 2021-12-06 _Entry.Original_release_date 2021-12-06 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Z. Wang Z. . . . 34676 2 S. Jurt S. . . . 34676 3 A. Dominguez-Martin A. . . . 34676 4 S. Johannsen S. . . . 34676 5 R. Sigel R. K.O. . . 34676 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID 5'UTR . 34676 BCL-2 . 34676 G-quadruplex . 34676 RNA . 34676 intramolecular . 34676 mRNA . 34676 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34676 spectral_peak_list 1 34676 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 182 34676 '15N chemical shifts' 12 34676 '1H chemical shifts' 184 34676 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-11-08 . original BMRB . 34676 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7Q6L 'BMRB Entry Tracking System' 34676 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34676 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8A17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto-oncogene ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Z. Wang Z. . . . 34676 1 2 S. Jurt S. . . . 34676 1 3 A. Dominguez-Martin A. . . . 34676 1 4 S. Johannsen S. . . . 34676 1 5 R. Sigel R. K.O. . . 34676 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34676 _Assembly.ID 1 _Assembly.Name "RNA (5'-R(*GP*GP*GP*CP*CP*AP*UP*AP*GP*GP*GP*UP*GP*GP*GP*AP*UP*CP*UP*GP*GP*G)-3')" _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34676 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34676 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCCAUAGGGUGGGAUCUG GG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 7225.339 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 34676 1 2 . G . 34676 1 3 . G . 34676 1 4 . C . 34676 1 5 . C . 34676 1 6 . A . 34676 1 7 . U . 34676 1 8 . A . 34676 1 9 . G . 34676 1 10 . G . 34676 1 11 . G . 34676 1 12 . U . 34676 1 13 . G . 34676 1 14 . G . 34676 1 15 . G . 34676 1 16 . A . 34676 1 17 . U . 34676 1 18 . C . 34676 1 19 . U . 34676 1 20 . G . 34676 1 21 . G . 34676 1 22 . G . 34676 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 34676 1 . G 2 2 34676 1 . G 3 3 34676 1 . C 4 4 34676 1 . C 5 5 34676 1 . A 6 6 34676 1 . U 7 7 34676 1 . A 8 8 34676 1 . G 9 9 34676 1 . G 10 10 34676 1 . G 11 11 34676 1 . U 12 12 34676 1 . G 13 13 34676 1 . G 14 14 34676 1 . G 15 15 34676 1 . A 16 16 34676 1 . U 17 17 34676 1 . C 18 18 34676 1 . U 19 19 34676 1 . G 20 20 34676 1 . G 21 21 34676 1 . G 22 22 34676 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34676 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 34676 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34676 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34676 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34676 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.3 mM BCL-2 6A8A17U, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' 'natural abundance' . . 1 $entity_1 . . 1.3 . . mM . . . . 34676 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34676 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1.3 mM BCL-2 6A8A17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' 'natural abundance' . . 1 $entity_1 . . 1.3 . . mM . . . . 34676 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 34676 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM G 15N-labeled BCL-2 6A8A17U, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' '[G 15N-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34676 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 34676 _Sample.ID 4 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.3 mM A 13C, 15N-labeled BCL-2 6A8A17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' '[A 13C, 15N-labeled]' . . 1 $entity_1 . . 0.3 . . mM . . . . 34676 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 34676 _Sample.ID 5 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.3 mM C 13C, 15N-labeled BCL-2 6A8A17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' '[C 13C, 15N-labeled]' . . 1 $entity_1 . . 0.3 . . mM . . . . 34676 5 stop_ save_ save_sample_6 _Sample.Sf_category sample _Sample.Sf_framecode sample_6 _Sample.Entry_ID 34676 _Sample.ID 6 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.5 mM G 13C-labeled BCL-2 6A8A17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' '[G 13C-labeled]' . . 1 $entity_1 . . 0.5 . . mM . . . . 34676 6 stop_ save_ save_sample_7 _Sample.Sf_category sample _Sample.Sf_framecode sample_7 _Sample.Entry_ID 34676 _Sample.ID 7 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.3 mM U 13C, 15N-labeled BCL-2 6A8A17U, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'BCL-2 6A8A17U' '[U 13C, 15N-labeled]' . . 1 $entity_1 . . 0.3 . . mM . . . . 34676 7 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 1 pH 7.0 . pH 34676 1 pressure 1 . atm 34676 1 temperature 298 . K 34676 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 2 pH 7.0 . pH 34676 2 pressure 1 . atm 34676 2 temperature 298 . K 34676 2 stop_ save_ save_sample_conditions_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_3 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 3 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 3 pH 7.0 . pH 34676 3 pressure 1 . atm 34676 3 temperature 298 . K 34676 3 stop_ save_ save_sample_conditions_4 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_4 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 4 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 4 pH 7.0 . pH 34676 4 pressure 1 . atm 34676 4 temperature 298 . K 34676 4 stop_ save_ save_sample_conditions_5 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_5 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 5 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 5 pH 7.0 . pH 34676 5 pressure 1 . atm 34676 5 temperature 298 . K 34676 5 stop_ save_ save_sample_conditions_6 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_6 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 6 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 6 pH 7.0 . pH 34676 6 pressure 1 . atm 34676 6 temperature 298 . K 34676 6 stop_ save_ save_sample_conditions_7 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_7 _Sample_condition_list.Entry_ID 34676 _Sample_condition_list.ID 7 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 2 . mM 34676 7 pH 7.0 . pH 34676 7 pressure 1 . atm 34676 7 temperature 298 . K 34676 7 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34676 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version 4.0.6 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 34676 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 34676 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34676 _Software.ID 2 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version 1.414 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee W, Tonelli M, Markley JL' . . 34676 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34676 2 'peak picking' . 34676 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34676 _Software.ID 3 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version 3.0 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 34676 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34676 3 'structure calculation' . 34676 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34676 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details Cryo-TCI _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 34676 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name . _NMR_spectrometer.Details Cryo-TXI _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34676 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 600 . . . 34676 1 2 NMR_spectrometer_2 Bruker AVANCE . 700 . . . 34676 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34676 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 3 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 4 '2D 1H-13C HSQC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 5 JR-HMBC no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 6 'H8N2 HNN-COSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 7 'H1N2 HNN-COSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 3 $sample_conditions_3 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 34676 1 8 'H1pC6/8 HMBC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 9 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 4 $sample_conditions_4 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 10 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 5 $sample_conditions_5 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 11 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 6 $sample_6 isotropic . . 6 $sample_conditions_6 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 12 'constant-time 1H-13C HSQC' no . . . . . . . . . . . . 7 $sample_7 isotropic . . 7 $sample_conditions_7 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34676 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34676 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0 external direct 0.25144953 . . . . . 34676 1 H 1 DSS 'methyl protons' . . . . ppm 0 external direct 1 . . . . . 34676 1 N 15 DSS 'methyl protons' . . . . ppm 0 external direct 0.10132912 . . . . . 34676 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34676 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details 'Non-exchangeable protons were assigned based on Sample 2, and exchangeable protons were assigned based on Sample 1.' _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34676 1 2 '2D 1H-1H NOESY' . . . 34676 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 34676 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1 H 1 11.459 0.001 . 1 . . . . . 1 G H1 . 34676 1 2 . 1 . 1 1 1 G H1' H 1 5.832 0.000 . 1 . . . . . 1 G H1' . 34676 1 3 . 1 . 1 1 1 G H2' H 1 4.953 0.000 . 1 . . . . . 1 G H2' . 34676 1 4 . 1 . 1 1 1 G H3' H 1 4.741 0.000 . 1 . . . . . 1 G H3' . 34676 1 5 . 1 . 1 1 1 G H4' H 1 4.651 0.001 . 1 . . . . . 1 G H4' . 34676 1 6 . 1 . 1 1 1 G H5' H 1 4.377 0.001 . 1 . . . . . 1 G H5' . 34676 1 7 . 1 . 1 1 1 G H5'' H 1 4.353 0.000 . 1 . . . . . 1 G H5'' . 34676 1 8 . 1 . 1 1 1 G H8 H 1 8.120 0.000 . 1 . . . . . 1 G H8 . 34676 1 9 . 1 . 1 1 1 G C1' C 13 90.015 0.069 . 1 . . . . . 1 G C1' . 34676 1 10 . 1 . 1 1 1 G C2' C 13 75.135 0.022 . 1 . . . . . 1 G C2' . 34676 1 11 . 1 . 1 1 1 G C3' C 13 75.191 0.051 . 1 . . . . . 1 G C3' . 34676 1 12 . 1 . 1 1 1 G C4 C 13 154.148 0.000 . 1 . . . . . 1 G C4 . 34676 1 13 . 1 . 1 1 1 G C4' C 13 84.656 0.002 . 1 . . . . . 1 G C4' . 34676 1 14 . 1 . 1 1 1 G C5 C 13 118.552 0.001 . 1 . . . . . 1 G C5 . 34676 1 15 . 1 . 1 1 1 G C5' C 13 68.745 0.005 . 1 . . . . . 1 G C5' . 34676 1 16 . 1 . 1 1 1 G C8 C 13 138.661 0.003 . 1 . . . . . 1 G C8 . 34676 1 17 . 1 . 1 1 1 G N2 N 15 80.376 0.001 . 1 . . . . . 1 G N2 . 34676 1 18 . 1 . 1 2 2 G H1 H 1 11.662 0.001 . 1 . . . . . 2 G H1 . 34676 1 19 . 1 . 1 2 2 G H1' H 1 5.892 0.001 . 1 . . . . . 2 G H1' . 34676 1 20 . 1 . 1 2 2 G H2' H 1 4.402 0.000 . 1 . . . . . 2 G H2' . 34676 1 21 . 1 . 1 2 2 G H3' H 1 4.710 0.002 . 1 . . . . . 2 G H3' . 34676 1 22 . 1 . 1 2 2 G H4' H 1 4.540 0.002 . 1 . . . . . 2 G H4' . 34676 1 23 . 1 . 1 2 2 G H5' H 1 4.546 0.002 . 1 . . . . . 2 G H5' . 34676 1 24 . 1 . 1 2 2 G H5'' H 1 4.445 0.001 . 1 . . . . . 2 G H5'' . 34676 1 25 . 1 . 1 2 2 G H8 H 1 7.964 0.001 . 1 . . . . . 2 G H8 . 34676 1 26 . 1 . 1 2 2 G H21 H 1 9.821 0.000 . 1 . . . . . 2 G H21 . 34676 1 27 . 1 . 1 2 2 G H22 H 1 5.854 0.000 . 1 . . . . . 2 G H22 . 34676 1 28 . 1 . 1 2 2 G C1' C 13 93.309 0.001 . 1 . . . . . 2 G C1' . 34676 1 29 . 1 . 1 2 2 G C2' C 13 75.069 0.011 . 1 . . . . . 2 G C2' . 34676 1 30 . 1 . 1 2 2 G C3' C 13 75.627 0.000 . 1 . . . . . 2 G C3' . 34676 1 31 . 1 . 1 2 2 G C4 C 13 153.531 0.000 . 1 . . . . . 2 G C4 . 34676 1 32 . 1 . 1 2 2 G C4' C 13 82.797 0.009 . 1 . . . . . 2 G C4' . 34676 1 33 . 1 . 1 2 2 G C5 C 13 118.018 0.010 . 1 . . . . . 2 G C5 . 34676 1 34 . 1 . 1 2 2 G C5' C 13 67.024 0.073 . 1 . . . . . 2 G C5' . 34676 1 35 . 1 . 1 2 2 G C8 C 13 137.806 0.009 . 1 . . . . . 2 G C8 . 34676 1 36 . 1 . 1 2 2 G N2 N 15 82.299 0.003 . 1 . . . . . 2 G N2 . 34676 1 37 . 1 . 1 3 3 G H1 H 1 11.542 0.001 . 1 . . . . . 3 G H1 . 34676 1 38 . 1 . 1 3 3 G H1' H 1 6.030 0.001 . 1 . . . . . 3 G H1' . 34676 1 39 . 1 . 1 3 3 G H2' H 1 4.264 0.001 . 1 . . . . . 3 G H2' . 34676 1 40 . 1 . 1 3 3 G H3' H 1 4.741 0.000 . 1 . . . . . 3 G H3' . 34676 1 41 . 1 . 1 3 3 G H4' H 1 4.311 0.000 . 1 . . . . . 3 G H4' . 34676 1 42 . 1 . 1 3 3 G H5' H 1 4.542 0.001 . 1 . . . . . 3 G H5' . 34676 1 43 . 1 . 1 3 3 G H5'' H 1 4.030 0.001 . 1 . . . . . 3 G H5'' . 34676 1 44 . 1 . 1 3 3 G H8 H 1 7.866 0.000 . 1 . . . . . 3 G H8 . 34676 1 45 . 1 . 1 3 3 G C1' C 13 90.805 0.026 . 1 . . . . . 3 G C1' . 34676 1 46 . 1 . 1 3 3 G C2' C 13 77.499 0.023 . 1 . . . . . 3 G C2' . 34676 1 47 . 1 . 1 3 3 G C3' C 13 75.194 0.047 . 1 . . . . . 3 G C3' . 34676 1 48 . 1 . 1 3 3 G C4 C 13 153.988 0.000 . 1 . . . . . 3 G C4 . 34676 1 49 . 1 . 1 3 3 G C4' C 13 84.002 0.046 . 1 . . . . . 3 G C4' . 34676 1 50 . 1 . 1 3 3 G C5 C 13 117.507 0.002 . 1 . . . . . 3 G C5 . 34676 1 51 . 1 . 1 3 3 G C5' C 13 66.045 0.025 . 1 . . . . . 3 G C5' . 34676 1 52 . 1 . 1 3 3 G C8 C 13 137.711 0.018 . 1 . . . . . 3 G C8 . 34676 1 53 . 1 . 1 3 3 G N2 N 15 81.771 0.002 . 1 . . . . . 3 G N2 . 34676 1 54 . 1 . 1 4 4 C H1' H 1 5.827 0.001 . 1 . . . . . 4 C H1' . 34676 1 55 . 1 . 1 4 4 C H2' H 1 4.249 0.001 . 1 . . . . . 4 C H2' . 34676 1 56 . 1 . 1 4 4 C H3' H 1 4.515 0.000 . 1 . . . . . 4 C H3' . 34676 1 57 . 1 . 1 4 4 C H4' H 1 4.175 0.001 . 1 . . . . . 4 C H4' . 34676 1 58 . 1 . 1 4 4 C H5 H 1 5.820 0.000 . 1 . . . . . 4 C H5 . 34676 1 59 . 1 . 1 4 4 C H5' H 1 4.208 0.002 . 1 . . . . . 4 C H5' . 34676 1 60 . 1 . 1 4 4 C H5'' H 1 4.019 0.002 . 1 . . . . . 4 C H5'' . 34676 1 61 . 1 . 1 4 4 C H6 H 1 7.655 0.001 . 1 . . . . . 4 C H6 . 34676 1 62 . 1 . 1 4 4 C C1' C 13 91.498 0.072 . 1 . . . . . 4 C C1' . 34676 1 63 . 1 . 1 4 4 C C2 C 13 159.641 0.000 . 1 . . . . . 4 C C2 . 34676 1 64 . 1 . 1 4 4 C C2' C 13 75.950 0.012 . 1 . . . . . 4 C C2' . 34676 1 65 . 1 . 1 4 4 C C3' C 13 76.604 0.041 . 1 . . . . . 4 C C3' . 34676 1 66 . 1 . 1 4 4 C C4' C 13 84.610 0.000 . 1 . . . . . 4 C C4' . 34676 1 67 . 1 . 1 4 4 C C5 C 13 98.936 0.061 . 1 . . . . . 4 C C5 . 34676 1 68 . 1 . 1 4 4 C C5' C 13 67.722 0.019 . 1 . . . . . 4 C C5' . 34676 1 69 . 1 . 1 4 4 C C6 C 13 143.459 0.089 . 1 . . . . . 4 C C6 . 34676 1 70 . 1 . 1 5 5 C H1' H 1 5.949 0.002 . 1 . . . . . 5 C H1' . 34676 1 71 . 1 . 1 5 5 C H2' H 1 4.351 0.000 . 1 . . . . . 5 C H2' . 34676 1 72 . 1 . 1 5 5 C H3' H 1 4.577 0.001 . 1 . . . . . 5 C H3' . 34676 1 73 . 1 . 1 5 5 C H4' H 1 4.396 0.001 . 1 . . . . . 5 C H4' . 34676 1 74 . 1 . 1 5 5 C H5 H 1 5.975 0.002 . 1 . . . . . 5 C H5 . 34676 1 75 . 1 . 1 5 5 C H5' H 1 4.116 0.002 . 1 . . . . . 5 C H5' . 34676 1 76 . 1 . 1 5 5 C H5'' H 1 4.062 0.001 . 1 . . . . . 5 C H5'' . 34676 1 77 . 1 . 1 5 5 C H6 H 1 7.798 0.001 . 1 . . . . . 5 C H6 . 34676 1 78 . 1 . 1 5 5 C C1' C 13 91.380 0.071 . 1 . . . . . 5 C C1' . 34676 1 79 . 1 . 1 5 5 C C2 C 13 160.096 0.015 . 1 . . . . . 5 C C2 . 34676 1 80 . 1 . 1 5 5 C C2' C 13 75.899 0.002 . 1 . . . . . 5 C C2' . 34676 1 81 . 1 . 1 5 5 C C3' C 13 76.781 0.074 . 1 . . . . . 5 C C3' . 34676 1 82 . 1 . 1 5 5 C C4' C 13 84.540 0.012 . 1 . . . . . 5 C C4' . 34676 1 83 . 1 . 1 5 5 C C5 C 13 99.316 0.047 . 1 . . . . . 5 C C5 . 34676 1 84 . 1 . 1 5 5 C C5' C 13 67.491 0.038 . 1 . . . . . 5 C C5' . 34676 1 85 . 1 . 1 5 5 C C6 C 13 143.691 0.034 . 1 . . . . . 5 C C6 . 34676 1 86 . 1 . 1 6 6 A H1' H 1 6.092 0.001 . 1 . . . . . 6 A H1' . 34676 1 87 . 1 . 1 6 6 A H2 H 1 8.216 0.000 . 1 . . . . . 6 A H2 . 34676 1 88 . 1 . 1 6 6 A H2' H 1 4.885 0.002 . 1 . . . . . 6 A H2' . 34676 1 89 . 1 . 1 6 6 A H3' H 1 4.821 0.002 . 1 . . . . . 6 A H3' . 34676 1 90 . 1 . 1 6 6 A H4' H 1 4.600 0.001 . 1 . . . . . 6 A H4' . 34676 1 91 . 1 . 1 6 6 A H5' H 1 4.277 0.000 . 1 . . . . . 6 A H5' . 34676 1 92 . 1 . 1 6 6 A H5'' H 1 4.216 0.001 . 1 . . . . . 6 A H5'' . 34676 1 93 . 1 . 1 6 6 A H8 H 1 8.459 0.000 . 1 . . . . . 6 A H8 . 34676 1 94 . 1 . 1 6 6 A C1' C 13 90.252 0.064 . 1 . . . . . 6 A C1' . 34676 1 95 . 1 . 1 6 6 A C2 C 13 155.457 0.121 . 1 . . . . . 6 A C2 . 34676 1 96 . 1 . 1 6 6 A C2' C 13 76.156 0.016 . 1 . . . . . 6 A C2' . 34676 1 97 . 1 . 1 6 6 A C3' C 13 76.947 0.092 . 1 . . . . . 6 A C3' . 34676 1 98 . 1 . 1 6 6 A C4 C 13 151.482 0.028 . 1 . . . . . 6 A C4 . 34676 1 99 . 1 . 1 6 6 A C4' C 13 85.257 0.041 . 1 . . . . . 6 A C4' . 34676 1 100 . 1 . 1 6 6 A C5 C 13 121.446 0.000 . 1 . . . . . 6 A C5 . 34676 1 101 . 1 . 1 6 6 A C5' C 13 67.687 0.023 . 1 . . . . . 6 A C5' . 34676 1 102 . 1 . 1 6 6 A C6 C 13 158.123 0.000 . 1 . . . . . 6 A C6 . 34676 1 103 . 1 . 1 6 6 A C8 C 13 142.243 0.027 . 1 . . . . . 6 A C8 . 34676 1 104 . 1 . 1 7 7 U H1' H 1 5.930 0.001 . 1 . . . . . 7 U H1' . 34676 1 105 . 1 . 1 7 7 U H2' H 1 4.318 0.001 . 1 . . . . . 7 U H2' . 34676 1 106 . 1 . 1 7 7 U H3' H 1 4.637 0.001 . 1 . . . . . 7 U H3' . 34676 1 107 . 1 . 1 7 7 U H4' H 1 4.439 0.002 . 1 . . . . . 7 U H4' . 34676 1 108 . 1 . 1 7 7 U H5 H 1 5.786 0.001 . 1 . . . . . 7 U H5 . 34676 1 109 . 1 . 1 7 7 U H5' H 1 4.159 0.001 . 1 . . . . . 7 U H5' . 34676 1 110 . 1 . 1 7 7 U H5'' H 1 4.155 0.001 . 1 . . . . . 7 U H5'' . 34676 1 111 . 1 . 1 7 7 U H6 H 1 7.780 0.001 . 1 . . . . . 7 U H6 . 34676 1 112 . 1 . 1 7 7 U C1' C 13 90.418 0.010 . 1 . . . . . 7 U C1' . 34676 1 113 . 1 . 1 7 7 U C2 C 13 154.396 0.014 . 1 . . . . . 7 U C2 . 34676 1 114 . 1 . 1 7 7 U C2' C 13 75.653 0.020 . 1 . . . . . 7 U C2' . 34676 1 115 . 1 . 1 7 7 U C3' C 13 77.269 0.001 . 1 . . . . . 7 U C3' . 34676 1 116 . 1 . 1 7 7 U C4' C 13 85.179 0.012 . 1 . . . . . 7 U C4' . 34676 1 117 . 1 . 1 7 7 U C5 C 13 105.445 0.013 . 1 . . . . . 7 U C5 . 34676 1 118 . 1 . 1 7 7 U C5' C 13 67.970 0.010 . 1 . . . . . 7 U C5' . 34676 1 119 . 1 . 1 7 7 U C6 C 13 143.881 0.026 . 1 . . . . . 7 U C6 . 34676 1 120 . 1 . 1 8 8 A H1' H 1 6.035 0.001 . 1 . . . . . 8 A H1' . 34676 1 121 . 1 . 1 8 8 A H2 H 1 8.061 0.001 . 1 . . . . . 8 A H2 . 34676 1 122 . 1 . 1 8 8 A H2' H 1 4.923 0.001 . 1 . . . . . 8 A H2' . 34676 1 123 . 1 . 1 8 8 A H3' H 1 4.923 0.000 . 1 . . . . . 8 A H3' . 34676 1 124 . 1 . 1 8 8 A H4' H 1 4.560 0.002 . 1 . . . . . 8 A H4' . 34676 1 125 . 1 . 1 8 8 A H5' H 1 4.217 0.001 . 1 . . . . . 8 A H5' . 34676 1 126 . 1 . 1 8 8 A H5'' H 1 4.204 0.002 . 1 . . . . . 8 A H5'' . 34676 1 127 . 1 . 1 8 8 A H8 H 1 8.384 0.001 . 1 . . . . . 8 A H8 . 34676 1 128 . 1 . 1 8 8 A C1' C 13 89.496 0.017 . 1 . . . . . 8 A C1' . 34676 1 129 . 1 . 1 8 8 A C2 C 13 155.218 0.104 . 1 . . . . . 8 A C2 . 34676 1 130 . 1 . 1 8 8 A C2' C 13 75.573 0.002 . 1 . . . . . 8 A C2' . 34676 1 131 . 1 . 1 8 8 A C3' C 13 77.111 0.008 . 1 . . . . . 8 A C3' . 34676 1 132 . 1 . 1 8 8 A C4 C 13 151.738 0.013 . 1 . . . . . 8 A C4 . 34676 1 133 . 1 . 1 8 8 A C4' C 13 85.736 0.025 . 1 . . . . . 8 A C4' . 34676 1 134 . 1 . 1 8 8 A C5 C 13 121.654 0.015 . 1 . . . . . 8 A C5 . 34676 1 135 . 1 . 1 8 8 A C5' C 13 67.888 0.015 . 1 . . . . . 8 A C5' . 34676 1 136 . 1 . 1 8 8 A C6 C 13 157.898 0.000 . 1 . . . . . 8 A C6 . 34676 1 137 . 1 . 1 8 8 A C8 C 13 142.172 0.017 . 1 . . . . . 8 A C8 . 34676 1 138 . 1 . 1 9 9 G H1 H 1 11.503 0.001 . 1 . . . . . 9 G H1 . 34676 1 139 . 1 . 1 9 9 G H1' H 1 5.817 0.001 . 1 . . . . . 9 G H1' . 34676 1 140 . 1 . 1 9 9 G H2' H 1 4.982 0.000 . 1 . . . . . 9 G H2' . 34676 1 141 . 1 . 1 9 9 G H3' H 1 4.799 0.001 . 1 . . . . . 9 G H3' . 34676 1 142 . 1 . 1 9 9 G H4' H 1 4.598 0.000 . 1 . . . . . 9 G H4' . 34676 1 143 . 1 . 1 9 9 G H5' H 1 4.308 0.000 . 1 . . . . . 9 G H5' . 34676 1 144 . 1 . 1 9 9 G H5'' H 1 4.289 0.001 . 1 . . . . . 9 G H5'' . 34676 1 145 . 1 . 1 9 9 G H8 H 1 8.090 0.001 . 1 . . . . . 9 G H8 . 34676 1 146 . 1 . 1 9 9 G C1' C 13 90.342 0.162 . 1 . . . . . 9 G C1' . 34676 1 147 . 1 . 1 9 9 G C2' C 13 75.059 0.054 . 1 . . . . . 9 G C2' . 34676 1 148 . 1 . 1 9 9 G C3' C 13 73.454 0.019 . 1 . . . . . 9 G C3' . 34676 1 149 . 1 . 1 9 9 G C4 C 13 154.346 0.000 . 1 . . . . . 9 G C4 . 34676 1 150 . 1 . 1 9 9 G C4' C 13 84.817 0.012 . 1 . . . . . 9 G C4' . 34676 1 151 . 1 . 1 9 9 G C5 C 13 118.315 0.016 . 1 . . . . . 9 G C5 . 34676 1 152 . 1 . 1 9 9 G C5' C 13 68.424 0.037 . 1 . . . . . 9 G C5' . 34676 1 153 . 1 . 1 9 9 G C8 C 13 138.425 0.011 . 1 . . . . . 9 G C8 . 34676 1 154 . 1 . 1 9 9 G N2 N 15 80.925 0.006 . 1 . . . . . 9 G N2 . 34676 1 155 . 1 . 1 10 10 G H1 H 1 11.521 0.001 . 1 . . . . . 10 G H1 . 34676 1 156 . 1 . 1 10 10 G H1' H 1 5.960 0.001 . 1 . . . . . 10 G H1' . 34676 1 157 . 1 . 1 10 10 G H2' H 1 4.687 0.001 . 1 . . . . . 10 G H2' . 34676 1 158 . 1 . 1 10 10 G H3' H 1 4.722 0.000 . 1 . . . . . 10 G H3' . 34676 1 159 . 1 . 1 10 10 G H4' H 1 4.642 0.000 . 1 . . . . . 10 G H4' . 34676 1 160 . 1 . 1 10 10 G H5' H 1 4.506 0.001 . 1 . . . . . 10 G H5' . 34676 1 161 . 1 . 1 10 10 G H5'' H 1 4.459 0.000 . 1 . . . . . 10 G H5'' . 34676 1 162 . 1 . 1 10 10 G H8 H 1 7.975 0.001 . 1 . . . . . 10 G H8 . 34676 1 163 . 1 . 1 10 10 G H21 H 1 9.362 0.000 . 1 . . . . . 10 G H21 . 34676 1 164 . 1 . 1 10 10 G H22 H 1 6.873 0.000 . 1 . . . . . 10 G H22 . 34676 1 165 . 1 . 1 10 10 G C1' C 13 93.447 0.005 . 1 . . . . . 10 G C1' . 34676 1 166 . 1 . 1 10 10 G C2' C 13 74.677 0.015 . 1 . . . . . 10 G C2' . 34676 1 167 . 1 . 1 10 10 G C3' C 13 73.370 0.001 . 1 . . . . . 10 G C3' . 34676 1 168 . 1 . 1 10 10 G C4 C 13 154.576 0.000 . 1 . . . . . 10 G C4 . 34676 1 169 . 1 . 1 10 10 G C4' C 13 83.591 0.001 . 1 . . . . . 10 G C4' . 34676 1 170 . 1 . 1 10 10 G C5 C 13 117.897 0.002 . 1 . . . . . 10 G C5 . 34676 1 171 . 1 . 1 10 10 G C5' C 13 67.843 0.010 . 1 . . . . . 10 G C5' . 34676 1 172 . 1 . 1 10 10 G C8 C 13 138.269 0.014 . 1 . . . . . 10 G C8 . 34676 1 173 . 1 . 1 10 10 G N2 N 15 82.782 0.010 . 1 . . . . . 10 G N2 . 34676 1 174 . 1 . 1 11 11 G H1 H 1 11.394 0.001 . 1 . . . . . 11 G H1 . 34676 1 175 . 1 . 1 11 11 G H1' H 1 6.195 0.001 . 1 . . . . . 11 G H1' . 34676 1 176 . 1 . 1 11 11 G H2' H 1 4.652 0.000 . 1 . . . . . 11 G H2' . 34676 1 177 . 1 . 1 11 11 G H3' H 1 4.792 0.000 . 1 . . . . . 11 G H3' . 34676 1 178 . 1 . 1 11 11 G H4' H 1 4.752 0.002 . 1 . . . . . 11 G H4' . 34676 1 179 . 1 . 1 11 11 G H5' H 1 4.774 0.000 . 1 . . . . . 11 G H5' . 34676 1 180 . 1 . 1 11 11 G H5'' H 1 4.085 0.001 . 1 . . . . . 11 G H5'' . 34676 1 181 . 1 . 1 11 11 G H8 H 1 7.905 0.000 . 1 . . . . . 11 G H8 . 34676 1 182 . 1 . 1 11 11 G C1' C 13 87.481 0.002 . 1 . . . . . 11 G C1' . 34676 1 183 . 1 . 1 11 11 G C2' C 13 77.482 0.009 . 1 . . . . . 11 G C2' . 34676 1 184 . 1 . 1 11 11 G C3' C 13 81.420 0.006 . 1 . . . . . 11 G C3' . 34676 1 185 . 1 . 1 11 11 G C4 C 13 155.463 0.000 . 1 . . . . . 11 G C4 . 34676 1 186 . 1 . 1 11 11 G C4' C 13 83.960 0.008 . 1 . . . . . 11 G C4' . 34676 1 187 . 1 . 1 11 11 G C5 C 13 116.916 0.000 . 1 . . . . . 11 G C5 . 34676 1 188 . 1 . 1 11 11 G C5' C 13 67.725 0.016 . 1 . . . . . 11 G C5' . 34676 1 189 . 1 . 1 11 11 G C8 C 13 138.003 0.001 . 1 . . . . . 11 G C8 . 34676 1 190 . 1 . 1 11 11 G N2 N 15 82.580 0.002 . 1 . . . . . 11 G N2 . 34676 1 191 . 1 . 1 12 12 U H1' H 1 6.222 0.001 . 1 . . . . . 12 U H1' . 34676 1 192 . 1 . 1 12 12 U H2' H 1 4.490 0.001 . 1 . . . . . 12 U H2' . 34676 1 193 . 1 . 1 12 12 U H3' H 1 4.921 0.000 . 1 . . . . . 12 U H3' . 34676 1 194 . 1 . 1 12 12 U H4' H 1 4.748 0.000 . 1 . . . . . 12 U H4' . 34676 1 195 . 1 . 1 12 12 U H5 H 1 6.032 0.002 . 1 . . . . . 12 U H5 . 34676 1 196 . 1 . 1 12 12 U H5' H 1 4.386 0.000 . 1 . . . . . 12 U H5' . 34676 1 197 . 1 . 1 12 12 U H5'' H 1 4.346 0.001 . 1 . . . . . 12 U H5'' . 34676 1 198 . 1 . 1 12 12 U H6 H 1 7.979 0.000 . 1 . . . . . 12 U H6 . 34676 1 199 . 1 . 1 12 12 U C1' C 13 89.089 0.004 . 1 . . . . . 12 U C1' . 34676 1 200 . 1 . 1 12 12 U C2 C 13 154.911 0.003 . 1 . . . . . 12 U C2 . 34676 1 201 . 1 . 1 12 12 U C2' C 13 76.191 0.000 . 1 . . . . . 12 U C2' . 34676 1 202 . 1 . 1 12 12 U C3' C 13 79.396 0.002 . 1 . . . . . 12 U C3' . 34676 1 203 . 1 . 1 12 12 U C4' C 13 86.072 0.007 . 1 . . . . . 12 U C4' . 34676 1 204 . 1 . 1 12 12 U C5 C 13 105.936 0.012 . 1 . . . . . 12 U C5 . 34676 1 205 . 1 . 1 12 12 U C5' C 13 68.670 0.008 . 1 . . . . . 12 U C5' . 34676 1 206 . 1 . 1 12 12 U C6 C 13 143.810 0.007 . 1 . . . . . 12 U C6 . 34676 1 207 . 1 . 1 13 13 G H1 H 1 11.429 0.001 . 1 . . . . . 13 G H1 . 34676 1 208 . 1 . 1 13 13 G H1' H 1 5.767 0.000 . 1 . . . . . 13 G H1' . 34676 1 209 . 1 . 1 13 13 G H2' H 1 4.957 0.000 . 1 . . . . . 13 G H2' . 34676 1 210 . 1 . 1 13 13 G H3' H 1 4.671 0.002 . 1 . . . . . 13 G H3' . 34676 1 211 . 1 . 1 13 13 G H4' H 1 4.575 0.001 . 1 . . . . . 13 G H4' . 34676 1 212 . 1 . 1 13 13 G H5' H 1 4.433 0.000 . 1 . . . . . 13 G H5' . 34676 1 213 . 1 . 1 13 13 G H5'' H 1 4.344 0.002 . 1 . . . . . 13 G H5'' . 34676 1 214 . 1 . 1 13 13 G H8 H 1 7.837 0.000 . 1 . . . . . 13 G H8 . 34676 1 215 . 1 . 1 13 13 G C1' C 13 94.128 0.005 . 1 . . . . . 13 G C1' . 34676 1 216 . 1 . 1 13 13 G C2' C 13 75.206 0.093 . 1 . . . . . 13 G C2' . 34676 1 217 . 1 . 1 13 13 G C3' C 13 76.105 0.006 . 1 . . . . . 13 G C3' . 34676 1 218 . 1 . 1 13 13 G C4 C 13 153.153 0.000 . 1 . . . . . 13 G C4 . 34676 1 219 . 1 . 1 13 13 G C4' C 13 82.802 0.010 . 1 . . . . . 13 G C4' . 34676 1 220 . 1 . 1 13 13 G C5 C 13 119.294 0.002 . 1 . . . . . 13 G C5 . 34676 1 221 . 1 . 1 13 13 G C5' C 13 67.182 0.007 . 1 . . . . . 13 G C5' . 34676 1 222 . 1 . 1 13 13 G C8 C 13 137.661 0.006 . 1 . . . . . 13 G C8 . 34676 1 223 . 1 . 1 13 13 G N2 N 15 80.303 0.003 . 1 . . . . . 13 G N2 . 34676 1 224 . 1 . 1 14 14 G H1 H 1 11.609 0.001 . 1 . . . . . 14 G H1 . 34676 1 225 . 1 . 1 14 14 G H1' H 1 5.916 0.001 . 1 . . . . . 14 G H1' . 34676 1 226 . 1 . 1 14 14 G H2' H 1 4.420 0.001 . 1 . . . . . 14 G H2' . 34676 1 227 . 1 . 1 14 14 G H3' H 1 4.826 0.001 . 1 . . . . . 14 G H3' . 34676 1 228 . 1 . 1 14 14 G H4' H 1 4.537 0.000 . 1 . . . . . 14 G H4' . 34676 1 229 . 1 . 1 14 14 G H5' H 1 4.660 0.000 . 1 . . . . . 14 G H5' . 34676 1 230 . 1 . 1 14 14 G H5'' H 1 4.221 0.000 . 1 . . . . . 14 G H5'' . 34676 1 231 . 1 . 1 14 14 G H8 H 1 7.898 0.000 . 1 . . . . . 14 G H8 . 34676 1 232 . 1 . 1 14 14 G H21 H 1 9.582 0.000 . 1 . . . . . 14 G H21 . 34676 1 233 . 1 . 1 14 14 G H22 H 1 6.032 0.000 . 1 . . . . . 14 G H22 . 34676 1 234 . 1 . 1 14 14 G C1' C 13 92.916 0.004 . 1 . . . . . 14 G C1' . 34676 1 235 . 1 . 1 14 14 G C2' C 13 75.211 0.006 . 1 . . . . . 14 G C2' . 34676 1 236 . 1 . 1 14 14 G C3' C 13 73.062 0.022 . 1 . . . . . 14 G C3' . 34676 1 237 . 1 . 1 14 14 G C4 C 13 153.767 0.000 . 1 . . . . . 14 G C4 . 34676 1 238 . 1 . 1 14 14 G C4' C 13 82.497 0.009 . 1 . . . . . 14 G C4' . 34676 1 239 . 1 . 1 14 14 G C5 C 13 117.919 0.002 . 1 . . . . . 14 G C5 . 34676 1 240 . 1 . 1 14 14 G C5' C 13 64.927 0.025 . 1 . . . . . 14 G C5' . 34676 1 241 . 1 . 1 14 14 G C8 C 13 137.510 0.012 . 1 . . . . . 14 G C8 . 34676 1 242 . 1 . 1 14 14 G N2 N 15 81.883 0.001 . 1 . . . . . 14 G N2 . 34676 1 243 . 1 . 1 15 15 G H1 H 1 11.326 0.001 . 1 . . . . . 15 G H1 . 34676 1 244 . 1 . 1 15 15 G H1' H 1 6.005 0.001 . 1 . . . . . 15 G H1' . 34676 1 245 . 1 . 1 15 15 G H2' H 1 4.305 0.001 . 1 . . . . . 15 G H2' . 34676 1 246 . 1 . 1 15 15 G H3' H 1 4.741 0.001 . 1 . . . . . 15 G H3' . 34676 1 247 . 1 . 1 15 15 G H4' H 1 4.274 0.002 . 1 . . . . . 15 G H4' . 34676 1 248 . 1 . 1 15 15 G H5' H 1 4.367 0.002 . 1 . . . . . 15 G H5' . 34676 1 249 . 1 . 1 15 15 G H5'' H 1 3.961 0.001 . 1 . . . . . 15 G H5'' . 34676 1 250 . 1 . 1 15 15 G H8 H 1 7.884 0.000 . 1 . . . . . 15 G H8 . 34676 1 251 . 1 . 1 15 15 G C1' C 13 90.343 0.012 . 1 . . . . . 15 G C1' . 34676 1 252 . 1 . 1 15 15 G C2' C 13 77.772 0.001 . 1 . . . . . 15 G C2' . 34676 1 253 . 1 . 1 15 15 G C3' C 13 76.555 0.028 . 1 . . . . . 15 G C3' . 34676 1 254 . 1 . 1 15 15 G C4 C 13 154.212 0.000 . 1 . . . . . 15 G C4 . 34676 1 255 . 1 . 1 15 15 G C4' C 13 84.542 0.023 . 1 . . . . . 15 G C4' . 34676 1 256 . 1 . 1 15 15 G C5 C 13 117.233 0.002 . 1 . . . . . 15 G C5 . 34676 1 257 . 1 . 1 15 15 G C5' C 13 66.372 0.019 . 1 . . . . . 15 G C5' . 34676 1 258 . 1 . 1 15 15 G C8 C 13 137.808 0.023 . 1 . . . . . 15 G C8 . 34676 1 259 . 1 . 1 15 15 G N2 N 15 82.434 0.009 . 1 . . . . . 15 G N2 . 34676 1 260 . 1 . 1 16 16 A H1' H 1 6.082 0.001 . 1 . . . . . 16 A H1' . 34676 1 261 . 1 . 1 16 16 A H2 H 1 8.109 0.001 . 1 . . . . . 16 A H2 . 34676 1 262 . 1 . 1 16 16 A H2' H 1 4.826 0.002 . 1 . . . . . 16 A H2' . 34676 1 263 . 1 . 1 16 16 A H3' H 1 4.779 0.000 . 1 . . . . . 16 A H3' . 34676 1 264 . 1 . 1 16 16 A H4' H 1 4.559 0.001 . 1 . . . . . 16 A H4' . 34676 1 265 . 1 . 1 16 16 A H5' H 1 4.320 0.002 . 1 . . . . . 16 A H5' . 34676 1 266 . 1 . 1 16 16 A H5'' H 1 4.135 0.001 . 1 . . . . . 16 A H5'' . 34676 1 267 . 1 . 1 16 16 A H8 H 1 8.427 0.001 . 1 . . . . . 16 A H8 . 34676 1 268 . 1 . 1 16 16 A C1' C 13 89.031 0.033 . 1 . . . . . 16 A C1' . 34676 1 269 . 1 . 1 16 16 A C2 C 13 155.505 0.107 . 1 . . . . . 16 A C2 . 34676 1 270 . 1 . 1 16 16 A C2' C 13 75.971 0.018 . 1 . . . . . 16 A C2' . 34676 1 271 . 1 . 1 16 16 A C3' C 13 77.623 0.000 . 1 . . . . . 16 A C3' . 34676 1 272 . 1 . 1 16 16 A C4 C 13 151.799 0.015 . 1 . . . . . 16 A C4 . 34676 1 273 . 1 . 1 16 16 A C4' C 13 85.784 0.004 . 1 . . . . . 16 A C4' . 34676 1 274 . 1 . 1 16 16 A C5 C 13 121.752 0.006 . 1 . . . . . 16 A C5 . 34676 1 275 . 1 . 1 16 16 A C5' C 13 68.386 0.011 . 1 . . . . . 16 A C5' . 34676 1 276 . 1 . 1 16 16 A C6 C 13 158.219 0.000 . 1 . . . . . 16 A C6 . 34676 1 277 . 1 . 1 16 16 A C8 C 13 142.266 0.021 . 1 . . . . . 16 A C8 . 34676 1 278 . 1 . 1 17 17 U H1' H 1 6.044 0.001 . 1 . . . . . 17 U H1' . 34676 1 279 . 1 . 1 17 17 U H2' H 1 4.479 0.001 . 1 . . . . . 17 U H2' . 34676 1 280 . 1 . 1 17 17 U H3' H 1 4.675 0.000 . 1 . . . . . 17 U H3' . 34676 1 281 . 1 . 1 17 17 U H4' H 1 4.511 0.000 . 1 . . . . . 17 U H4' . 34676 1 282 . 1 . 1 17 17 U H5 H 1 5.931 0.001 . 1 . . . . . 17 U H5 . 34676 1 283 . 1 . 1 17 17 U H5' H 1 4.264 0.000 . 1 . . . . . 17 U H5' . 34676 1 284 . 1 . 1 17 17 U H5'' H 1 4.202 0.002 . 1 . . . . . 17 U H5'' . 34676 1 285 . 1 . 1 17 17 U H6 H 1 7.938 0.001 . 1 . . . . . 17 U H6 . 34676 1 286 . 1 . 1 17 17 U C1' C 13 90.910 0.026 . 1 . . . . . 17 U C1' . 34676 1 287 . 1 . 1 17 17 U C2 C 13 154.471 0.003 . 1 . . . . . 17 U C2 . 34676 1 288 . 1 . 1 17 17 U C2' C 13 75.504 0.021 . 1 . . . . . 17 U C2' . 34676 1 289 . 1 . 1 17 17 U C3' C 13 76.851 0.040 . 1 . . . . . 17 U C3' . 34676 1 290 . 1 . 1 17 17 U C4' C 13 85.351 0.011 . 1 . . . . . 17 U C4' . 34676 1 291 . 1 . 1 17 17 U C5 C 13 105.463 0.006 . 1 . . . . . 17 U C5 . 34676 1 292 . 1 . 1 17 17 U C5' C 13 67.805 0.018 . 1 . . . . . 17 U C5' . 34676 1 293 . 1 . 1 17 17 U C6 C 13 144.191 0.008 . 1 . . . . . 17 U C6 . 34676 1 294 . 1 . 1 18 18 C H1' H 1 5.940 0.001 . 1 . . . . . 18 C H1' . 34676 1 295 . 1 . 1 18 18 C H2' H 1 4.402 0.002 . 1 . . . . . 18 C H2' . 34676 1 296 . 1 . 1 18 18 C H3' H 1 4.619 0.001 . 1 . . . . . 18 C H3' . 34676 1 297 . 1 . 1 18 18 C H4' H 1 4.447 0.000 . 1 . . . . . 18 C H4' . 34676 1 298 . 1 . 1 18 18 C H5 H 1 6.019 0.001 . 1 . . . . . 18 C H5 . 34676 1 299 . 1 . 1 18 18 C H5' H 1 4.245 0.001 . 1 . . . . . 18 C H5' . 34676 1 300 . 1 . 1 18 18 C H5'' H 1 4.159 0.001 . 1 . . . . . 18 C H5'' . 34676 1 301 . 1 . 1 18 18 C H6 H 1 7.840 0.001 . 1 . . . . . 18 C H6 . 34676 1 302 . 1 . 1 18 18 C C1' C 13 91.736 0.002 . 1 . . . . . 18 C C1' . 34676 1 303 . 1 . 1 18 18 C C2 C 13 160.004 0.000 . 1 . . . . . 18 C C2 . 34676 1 304 . 1 . 1 18 18 C C2' C 13 75.742 0.003 . 1 . . . . . 18 C C2' . 34676 1 305 . 1 . 1 18 18 C C3' C 13 76.698 0.001 . 1 . . . . . 18 C C3' . 34676 1 306 . 1 . 1 18 18 C C4' C 13 84.776 0.027 . 1 . . . . . 18 C C4' . 34676 1 307 . 1 . 1 18 18 C C5 C 13 99.233 0.034 . 1 . . . . . 18 C C5 . 34676 1 308 . 1 . 1 18 18 C C5' C 13 67.788 0.045 . 1 . . . . . 18 C C5' . 34676 1 309 . 1 . 1 18 18 C C6 C 13 144.025 0.065 . 1 . . . . . 18 C C6 . 34676 1 310 . 1 . 1 19 19 U H1' H 1 5.943 0.001 . 1 . . . . . 19 U H1' . 34676 1 311 . 1 . 1 19 19 U H2' H 1 4.489 0.002 . 1 . . . . . 19 U H2' . 34676 1 312 . 1 . 1 19 19 U H3' H 1 4.778 0.001 . 1 . . . . . 19 U H3' . 34676 1 313 . 1 . 1 19 19 U H4' H 1 4.481 0.001 . 1 . . . . . 19 U H4' . 34676 1 314 . 1 . 1 19 19 U H5 H 1 5.705 0.001 . 1 . . . . . 19 U H5 . 34676 1 315 . 1 . 1 19 19 U H5' H 1 4.271 0.001 . 1 . . . . . 19 U H5' . 34676 1 316 . 1 . 1 19 19 U H5'' H 1 4.175 0.000 . 1 . . . . . 19 U H5'' . 34676 1 317 . 1 . 1 19 19 U H6 H 1 7.818 0.001 . 1 . . . . . 19 U H6 . 34676 1 318 . 1 . 1 19 19 U C1' C 13 91.043 0.029 . 1 . . . . . 19 U C1' . 34676 1 319 . 1 . 1 19 19 U C2 C 13 154.307 0.007 . 1 . . . . . 19 U C2 . 34676 1 320 . 1 . 1 19 19 U C2' C 13 75.394 0.008 . 1 . . . . . 19 U C2' . 34676 1 321 . 1 . 1 19 19 U C3' C 13 76.911 0.000 . 1 . . . . . 19 U C3' . 34676 1 322 . 1 . 1 19 19 U C4' C 13 85.166 0.027 . 1 . . . . . 19 U C4' . 34676 1 323 . 1 . 1 19 19 U C5 C 13 105.076 0.001 . 1 . . . . . 19 U C5 . 34676 1 324 . 1 . 1 19 19 U C5' C 13 67.662 0.027 . 1 . . . . . 19 U C5' . 34676 1 325 . 1 . 1 19 19 U C6 C 13 143.860 0.015 . 1 . . . . . 19 U C6 . 34676 1 326 . 1 . 1 20 20 G H1 H 1 11.553 0.002 . 1 . . . . . 20 G H1 . 34676 1 327 . 1 . 1 20 20 G H1' H 1 5.817 0.000 . 1 . . . . . 20 G H1' . 34676 1 328 . 1 . 1 20 20 G H2' H 1 4.957 0.001 . 1 . . . . . 20 G H2' . 34676 1 329 . 1 . 1 20 20 G H3' H 1 4.735 0.001 . 1 . . . . . 20 G H3' . 34676 1 330 . 1 . 1 20 20 G H4' H 1 4.593 0.001 . 1 . . . . . 20 G H4' . 34676 1 331 . 1 . 1 20 20 G H5' H 1 4.340 0.000 . 1 . . . . . 20 G H5' . 34676 1 332 . 1 . 1 20 20 G H5'' H 1 4.288 0.000 . 1 . . . . . 20 G H5'' . 34676 1 333 . 1 . 1 20 20 G H8 H 1 8.074 0.000 . 1 . . . . . 20 G H8 . 34676 1 334 . 1 . 1 20 20 G C1' C 13 90.556 0.092 . 1 . . . . . 20 G C1' . 34676 1 335 . 1 . 1 20 20 G C2' C 13 75.141 0.028 . 1 . . . . . 20 G C2' . 34676 1 336 . 1 . 1 20 20 G C3' C 13 76.008 0.012 . 1 . . . . . 20 G C3' . 34676 1 337 . 1 . 1 20 20 G C4 C 13 154.194 0.000 . 1 . . . . . 20 G C4 . 34676 1 338 . 1 . 1 20 20 G C4' C 13 84.505 0.025 . 1 . . . . . 20 G C4' . 34676 1 339 . 1 . 1 20 20 G C5 C 13 118.589 0.003 . 1 . . . . . 20 G C5 . 34676 1 340 . 1 . 1 20 20 G C5' C 13 68.517 0.019 . 1 . . . . . 20 G C5' . 34676 1 341 . 1 . 1 20 20 G C8 C 13 138.424 0.001 . 1 . . . . . 20 G C8 . 34676 1 342 . 1 . 1 20 20 G N2 N 15 80.430 0.007 . 1 . . . . . 20 G N2 . 34676 1 343 . 1 . 1 21 21 G H1 H 1 11.551 0.002 . 1 . . . . . 21 G H1 . 34676 1 344 . 1 . 1 21 21 G H1' H 1 6.027 0.001 . 1 . . . . . 21 G H1' . 34676 1 345 . 1 . 1 21 21 G H2' H 1 4.503 0.001 . 1 . . . . . 21 G H2' . 34676 1 346 . 1 . 1 21 21 G H3' H 1 4.801 0.001 . 1 . . . . . 21 G H3' . 34676 1 347 . 1 . 1 21 21 G H4' H 1 4.620 0.001 . 1 . . . . . 21 G H4' . 34676 1 348 . 1 . 1 21 21 G H5' H 1 4.558 0.000 . 1 . . . . . 21 G H5' . 34676 1 349 . 1 . 1 21 21 G H5'' H 1 4.460 0.001 . 1 . . . . . 21 G H5'' . 34676 1 350 . 1 . 1 21 21 G H8 H 1 7.968 0.001 . 1 . . . . . 21 G H8 . 34676 1 351 . 1 . 1 21 21 G H21 H 1 9.715 0.000 . 1 . . . . . 21 G H21 . 34676 1 352 . 1 . 1 21 21 G H22 H 1 5.957 0.000 . 1 . . . . . 21 G H22 . 34676 1 353 . 1 . 1 21 21 G C1' C 13 93.217 0.020 . 1 . . . . . 21 G C1' . 34676 1 354 . 1 . 1 21 21 G C2' C 13 75.229 0.003 . 1 . . . . . 21 G C2' . 34676 1 355 . 1 . 1 21 21 G C3' C 13 76.750 0.010 . 1 . . . . . 21 G C3' . 34676 1 356 . 1 . 1 21 21 G C4 C 13 153.780 0.000 . 1 . . . . . 21 G C4 . 34676 1 357 . 1 . 1 21 21 G C4' C 13 82.959 0.023 . 1 . . . . . 21 G C4' . 34676 1 358 . 1 . 1 21 21 G C5 C 13 117.965 0.004 . 1 . . . . . 21 G C5 . 34676 1 359 . 1 . 1 21 21 G C5' C 13 66.806 0.045 . 1 . . . . . 21 G C5' . 34676 1 360 . 1 . 1 21 21 G C8 C 13 137.999 0.014 . 1 . . . . . 21 G C8 . 34676 1 361 . 1 . 1 21 21 G N2 N 15 82.102 0.002 . 1 . . . . . 21 G N2 . 34676 1 362 . 1 . 1 22 22 G H1 H 1 11.352 0.000 . 1 . . . . . 22 G H1 . 34676 1 363 . 1 . 1 22 22 G H1' H 1 6.117 0.000 . 1 . . . . . 22 G H1' . 34676 1 364 . 1 . 1 22 22 G H2' H 1 4.199 0.001 . 1 . . . . . 22 G H2' . 34676 1 365 . 1 . 1 22 22 G H3' H 1 4.465 0.000 . 1 . . . . . 22 G H3' . 34676 1 366 . 1 . 1 22 22 G H4' H 1 4.371 0.000 . 1 . . . . . 22 G H4' . 34676 1 367 . 1 . 1 22 22 G H5' H 1 4.646 0.002 . 1 . . . . . 22 G H5' . 34676 1 368 . 1 . 1 22 22 G H5'' H 1 4.136 0.000 . 1 . . . . . 22 G H5'' . 34676 1 369 . 1 . 1 22 22 G H8 H 1 7.845 0.000 . 1 . . . . . 22 G H8 . 34676 1 370 . 1 . 1 22 22 G C1' C 13 90.709 0.008 . 1 . . . . . 22 G C1' . 34676 1 371 . 1 . 1 22 22 G C2' C 13 78.288 0.005 . 1 . . . . . 22 G C2' . 34676 1 372 . 1 . 1 22 22 G C3' C 13 71.031 0.016 . 1 . . . . . 22 G C3' . 34676 1 373 . 1 . 1 22 22 G C4 C 13 154.056 0.000 . 1 . . . . . 22 G C4 . 34676 1 374 . 1 . 1 22 22 G C4' C 13 84.462 0.004 . 1 . . . . . 22 G C4' . 34676 1 375 . 1 . 1 22 22 G C5 C 13 117.440 0.003 . 1 . . . . . 22 G C5 . 34676 1 376 . 1 . 1 22 22 G C5' C 13 66.251 0.016 . 1 . . . . . 22 G C5' . 34676 1 377 . 1 . 1 22 22 G C8 C 13 137.613 0.038 . 1 . . . . . 22 G C8 . 34676 1 378 . 1 . 1 22 22 G N2 N 15 82.193 0.004 . 1 . . . . . 22 G N2 . 34676 1 stop_ save_ ######################### # Spectral peak lists # ######################### save_spectral_peak_list_1 _Spectral_peak_list.Sf_category spectral_peak_list _Spectral_peak_list.Sf_framecode spectral_peak_list_1 _Spectral_peak_list.Entry_ID 34676 _Spectral_peak_list.ID 1 _Spectral_peak_list.Name . _Spectral_peak_list.Sample_ID 1 _Spectral_peak_list.Sample_label $sample_1 _Spectral_peak_list.Sample_condition_list_ID 1 _Spectral_peak_list.Sample_condition_list_label $sample_conditions_1 _Spectral_peak_list.Chem_shift_reference_ID 1 _Spectral_peak_list.Chem_shift_reference_label $chem_shift_reference_1 _Spectral_peak_list.Experiment_ID 1 _Spectral_peak_list.Experiment_name '2D 1H-1H NOESY' _Spectral_peak_list.Experiment_class . _Spectral_peak_list.Experiment_type . _Spectral_peak_list.Number_of_spectral_dimensions 2 _Spectral_peak_list.Chemical_shift_list . _Spectral_peak_list.Assigned_chem_shift_list_ID 1 _Spectral_peak_list.Assigned_chem_shift_list_label $assigned_chemical_shifts_1 _Spectral_peak_list.Details . _Spectral_peak_list.Text_data_format text _Spectral_peak_list.Text_data ; 524 peaks Assignment Shift (ppm) G1H1'-H1' 5.832 5.832 G1H1'-H8 5.832 8.120 G1H1'-G2H8 5.831 7.964 G1H1'-A8H2 5.831 8.060 G1H2'-H1' 4.953 5.831 G1H2'-H8 4.953 8.120 G1H2'-G2H1' 4.953 5.892 G1H2'-G2H8 4.952 7.963 G1H3'-H1' 4.741 5.831 G1H3'-H8 4.742 8.119 G1H3'-G2H8 4.741 7.964 G1H4'-H1' 4.652 5.832 G1H4'-H8 4.652 8.120 G1H4'-G2H8 4.650 7.965 G1H5"-H1' 4.353 5.832 G1H5"-H8 4.353 8.120 G1H5"-G2H8 4.352 7.965 G1H5'-H1' 4.377 5.832 G1H5'-H8 4.378 8.120 G1H8-H8 8.120 8.119 G2H1'-H1' 5.892 5.892 G2H1'-H8 5.893 7.964 G2H1'-G3H8 5.892 7.866 G2H1'-G9H8 5.892 8.090 G2H2'-H1' 4.402 5.891 G2H2'-H8 4.401 7.965 G2H2'-G3H1' 4.401 6.028 G2H2'-G3H8 4.402 7.866 G2H3'-H1' 4.708 5.891 G2H3'-H8 4.711 7.964 G2H3'-G3H8 4.712 7.866 G2H4'-H1' 4.538 5.891 G2H4'-H8 4.542 7.965 G2H5"-G1H1' 4.443 5.831 G2H5"-H1' 4.446 5.892 G2H5"-H8 4.445 7.965 G2H5'-G1H1' 4.544 5.832 G2H5'-H1' 4.544 5.892 G2H5'-H8 4.549 7.965 G2H8-G1H8 7.963 8.120 G2H8-H8 7.961 7.962 G3H1'-H1' 6.031 6.030 G3H1'-H8 6.028 7.866 G3H1'-C4H6 6.030 7.655 G3H1'-A6H2 6.031 8.216 G3H2'-H1' 4.265 6.030 G3H2'-H8 4.264 7.866 G3H2'-C4H6 4.261 7.655 G3H2'-A6H2 4.264 8.216 G3H3'-H1' 4.741 6.029 G3H3'-H8 4.740 7.866 G3H3'-C4H6 4.741 7.655 G3H4'-H1' 4.311 6.030 G3H4'-H8 4.311 7.866 G3H4'-C4H6 4.311 7.656 G3H4'-A6H2 4.312 8.216 G3H5"-G2H1' 4.032 5.891 G3H5"-H1' 4.029 6.030 G3H5"-H2' 4.028 4.264 G3H5"-H4' 4.031 4.311 G3H5"-H8 4.030 7.866 G3H5'-H1' 4.543 6.029 G3H5'-H8 4.541 7.866 G3H8-G2H8 7.866 7.962 G3H8-H8 7.865 7.865 C4H1'-H1' 5.826 5.825 C4H1'-H6 5.827 7.654 C4H1'-C5H6 5.825 7.797 C4H1'-A6H2 5.824 8.217 C4H1'-A6H8 5.825 8.458 C4H2'-H1' 4.249 5.828 C4H2'-H6 4.248 7.656 C4H2'-C5H5 4.248 5.977 C4H2'-C5H6 4.249 7.799 C4H3'-H1' 4.516 5.827 C4H3'-H6 4.515 7.656 C4H3'-C5H6 4.515 7.798 C4H4'-H1' 4.176 5.828 C4H4'-H6 4.175 7.656 C4H4'-A6H1' 4.173 6.093 C4H4'-A6H2 4.176 8.217 C4H4'-A6H8 4.175 8.459 C4H5-H5 5.820 5.819 C4H5-H6 5.820 7.655 C4H5"-H1' 4.021 5.826 C4H5"-H2' 4.017 4.250 C4H5"-H4' 4.018 4.176 C4H5"-H5' 4.017 4.206 C4H5"-H6 4.020 7.656 C4H5"-C5H5 4.021 5.976 C4H5"-C5H6 4.017 7.798 C4H5"-A6H1' 4.021 6.092 C4H5"-A6H2 4.022 8.216 C4H5'-H1' 4.208 5.828 C4H5'-H6 4.208 7.655 C4H5'-C5H5 4.206 5.978 C4H5'-A6H2 4.212 8.216 C4H6-G3H8 7.655 7.866 C4H6-H6 7.654 7.656 C4H6-A6H2 7.652 8.216 C5H1'-H1' 5.947 5.948 C5H1'-H6 5.945 7.798 C5H1'-A6H2 5.947 8.216 C5H1'-A6H8 5.951 8.459 C5H2'-H1' 4.350 5.950 C5H2'-H5 4.351 5.975 C5H2'-H6 4.351 7.798 C5H2'-A6H8 4.350 8.459 C5H3'-H1' 4.577 5.950 C5H3'-H5 4.576 5.975 C5H3'-H6 4.578 7.798 C5H3'-A6H8 4.578 8.459 C5H4'-H1' 4.396 5.950 C5H4'-H6 4.397 7.799 C5H4'-A6H1' 4.396 6.091 C5H4'-A6H2 4.398 8.216 C5H4'-A6H8 4.396 8.459 C5H5-C4H6 5.972 7.655 C5H5-H5 5.974 5.975 C5H5-H6 5.975 7.798 C5H5"-C4H1' 4.060 5.828 C5H5"-H1' 4.060 5.950 C5H5"-H4' 4.064 4.396 C5H5"-H5' 4.063 4.113 C5H5"-H6 4.062 7.798 C5H5"-A6H8 4.061 8.459 C5H5'-C4H1' 4.116 5.828 C5H5'-H1' 4.115 5.950 C5H5'-H4' 4.115 4.396 C5H5'-H6 4.119 7.798 C5H5'-A6H8 4.116 8.459 C5H6-H6 7.798 7.798 C5H6-A6H8 7.797 8.459 A6H1'-C4H6 6.093 7.655 A6H1'-H1' 6.091 6.091 A6H1'-H2 6.092 8.216 A6H1'-H8 6.092 8.459 A6H1'-U7H6 6.092 7.780 A6H2-H2 8.217 8.216 A6H2'-H1' 4.884 6.092 A6H2'-H2 4.885 8.216 A6H2'-H8 4.885 8.459 A6H2'-U7H5 4.882 5.786 A6H2'-U7H6 4.885 7.780 A6H2'-A8H2 4.888 8.061 A6H3'-H1' 4.822 6.092 A6H3'-H8 4.822 8.459 A6H3'-U7H5 4.821 5.786 A6H3'-U7H6 4.822 7.780 A6H3'-A8H8 4.818 8.384 A6H4'-H1' 4.601 6.091 A6H4'-H8 4.599 8.459 A6H5"-H1' 4.217 6.093 A6H5"-H5' 4.215 4.277 A6H5"-H8 4.217 8.459 A6H5'-H1' 4.277 6.092 A6H5'-H8 4.277 8.459 A6H8-H8 8.459 8.459 U7H1'-A6H2 5.932 8.216 U7H1'-H1' 5.929 5.928 U7H1'-H6 5.930 7.779 U7H1'-A8H2 5.930 8.060 U7H1'-A8H8 5.930 8.384 U7H2'-H1' 4.319 5.931 U7H2'-H5 4.319 5.787 U7H2'-H6 4.317 7.780 U7H2'-A8H8 4.316 8.384 U7H3'-H1' 4.636 5.931 U7H3'-H6 4.637 7.780 U7H3'-A8H8 4.639 8.384 U7H4'-A6H2 4.436 8.216 U7H4'-H1' 4.441 5.931 U7H4'-H6 4.440 7.781 U7H4'-A8H1' 4.442 6.034 U7H4'-A8H2 4.437 8.061 U7H4'-A8H8 4.436 8.385 U7H5-A6H1' 5.787 6.092 U7H5-A6H8 5.788 8.459 U7H5-H1' 5.783 5.931 U7H5-H5 5.786 5.785 U7H5-H6 5.787 7.779 U7H5"-H1' 4.155 5.931 U7H5"-H4' 4.157 4.439 U7H5"-H6 4.156 7.779 U7H5"-A8H2 4.156 8.061 U7H5"-A8H8 4.153 8.383 U7H5'-H1' 4.159 5.931 U7H5'-H6 4.160 7.780 U7H5'-A8H2 4.159 8.061 U7H5'-A8H8 4.157 8.384 U7H6-A6H8 7.780 8.459 U7H6-H6 7.779 7.778 U7H6-A8H8 7.783 8.385 A8H1'-H1' 6.035 6.035 A8H1'-H2 6.035 8.060 A8H1'-H8 6.035 8.384 A8H1'-G9H8 6.035 8.089 A8H2-H2 8.062 8.062 A8H2'-H1' 4.924 6.036 A8H2'-H2 4.922 8.059 A8H2'-H8 4.924 8.385 A8H2'-G9H8 4.923 8.090 A8H3'-U7H1' 4.923 5.930 A8H3'-H1' 4.923 6.034 A8H3'-H8 4.923 8.385 A8H4'-H1' 4.559 6.034 A8H4'-H8 4.560 8.384 A8H4'-G9H8 4.559 8.090 A8H5"-U7H1' 4.201 5.931 A8H5"-H1' 4.202 6.034 A8H5"-H2 4.206 8.061 A8H5"-H4' 4.206 4.563 A8H5"-H8 4.203 8.385 A8H5"-G9H8 4.206 8.090 A8H5'-U7H1' 4.216 5.931 A8H5'-H1' 4.218 6.034 A8H5'-H8 4.217 8.385 A8H8-H8 8.384 8.384 G9H1'-H1' 5.819 5.817 G9H1'-H8 5.817 8.089 G9H1'-G10H1' 5.817 5.960 G9H1'-G10H8 5.817 7.975 G9H2'-H1' 4.982 5.817 G9H2'-H8 4.982 8.090 G9H2'-G10H1' 4.981 5.960 G9H2'-G10H8 4.981 7.975 G9H3'-H1' 4.800 5.817 G9H3'-H8 4.800 8.089 G9H3'-G10H8 4.797 7.975 G9H4'-H1' 4.597 5.816 G9H4'-H8 4.598 8.089 G9H4'-G10H8 4.598 7.974 G9H5"-H1' 4.290 5.817 G9H5"-H8 4.289 8.089 G9H5"-G10H8 4.287 7.975 G9H5'-H1' 4.308 5.817 G9H5'-H8 4.309 8.089 G9H5'-G10H8 4.308 7.975 G9H8-A8H8 8.092 8.384 G9H8-H8 8.090 8.090 G10H1'-H1' 5.961 5.959 G10H1'-H8 5.960 7.975 G10H1'-G11H8 5.960 7.905 G10H1'-G13H8 5.959 7.838 G10H2'-H1' 4.687 5.959 G10H2'-H8 4.688 7.974 G10H2'-G11H1' 4.684 6.195 G10H2'-G11H8 4.687 7.904 G10H3'-H1' 4.722 5.959 G10H3'-H8 4.722 7.975 G10H3'-G11H8 4.723 7.905 G10H4'-H1' 4.641 5.959 G10H4'-H8 4.642 7.975 G10H5"-H1' 4.459 5.960 G10H5"-H8 4.459 7.975 G10H5'-H1' 4.507 5.960 G10H5'-H8 4.505 7.975 G10H8-G9H8 7.975 8.089 G10H8-H8 7.974 7.975 G11H1'-H1' 6.194 6.193 G11H1'-H8 6.195 7.905 G11H2'-H1' 4.652 6.195 G11H2'-H8 4.652 7.905 G11H3'-G10H1' 4.793 5.959 G11H3'-H1' 4.792 6.195 G11H3'-H8 4.792 7.905 G11H4'-H1' 4.754 6.195 G11H4'-H8 4.750 7.905 G11H5"-G10H1' 4.083 5.959 G11H5"-H1' 4.086 6.195 G11H5"-H8 4.086 7.905 G11H5'-H1' 4.774 6.195 G11H5'-H8 4.773 7.905 G11H5'-U12H1' 4.774 6.221 G11H8-G10H8 7.904 7.977 G11H8-H8 7.904 7.905 U12H1'-H1' 6.223 6.223 U12H1'-H6 6.223 7.979 U12H2'-H1' 4.491 6.223 U12H2'-H6 4.490 7.979 U12H3'-G11H1' 4.922 6.195 U12H3'-H1' 4.921 6.221 U12H3'-H6 4.921 7.979 U12H4'-H1' 4.748 6.221 U12H4'-H6 4.748 7.979 U12H4'-G13H8 4.748 7.837 U12H5-H5 6.031 6.030 U12H5-H6 6.034 7.979 U12H5"-G11H1' 4.345 6.195 U12H5"-H1' 4.346 6.223 U12H5"-H6 4.348 7.978 U12H5'-G11H1' 4.386 6.195 U12H5'-H1' 4.386 6.223 U12H5'-H6 4.386 7.979 U12H6-H6 7.979 7.979 G13H1'-H1' 5.767 5.767 G13H1'-H8 5.767 7.837 G13H1'-G14H1' 5.767 5.915 G13H1'-G14H8 5.768 7.898 G13H2'-H1' 4.956 5.767 G13H2'-H8 4.957 7.837 G13H2'-G14H1' 4.956 5.917 G13H2'-G14H8 4.957 7.898 G13H3'-H1' 4.669 5.768 G13H3'-H8 4.672 7.837 G13H3'-G14H8 4.673 7.898 G13H4'-H1' 4.574 5.767 G13H4'-H8 4.574 7.837 G13H4'-G14H8 4.577 7.897 G13H5"-H1' 4.348 5.768 G13H5"-H5' 4.343 4.433 G13H5"-H8 4.343 7.837 G13H5"-G14H8 4.343 7.898 G13H5'-U12H1' 4.433 6.223 G13H5'-H1' 4.432 5.767 G13H5'-H8 4.433 7.837 G13H8-H8 7.838 7.837 G14H1'-H1' 5.916 5.915 G14H1'-H8 5.915 7.898 G14H1'-G15H8 5.915 7.884 G14H1'-G20H8 5.916 8.074 G14H2'-H1' 4.420 5.917 G14H2'-H8 4.421 7.898 G14H2'-G15H1' 4.418 6.005 G14H2'-G15H8 4.420 7.884 G14H3'-H1' 4.825 5.917 G14H3'-H8 4.827 7.898 G14H3'-G15H8 4.825 7.885 G14H4'-H1' 4.536 5.917 G14H4'-H8 4.537 7.899 G14H5"-H1' 4.221 5.917 G14H5"-H8 4.221 7.898 G14H5'-H1' 4.660 5.917 G14H5'-H8 4.660 7.898 G14H8-H8 7.899 7.898 G15H1'-H1' 6.004 6.004 G15H1'-H8 6.004 7.884 G15H1'-A16H2 6.006 8.108 G15H1'-A16H8 6.005 8.427 G15H2'-H1' 4.304 6.005 G15H2'-H8 4.305 7.884 G15H2'-A16H1' 4.304 6.082 G15H2'-A16H8 4.307 8.426 G15H3'-H1' 4.742 6.005 G15H3'-H8 4.742 7.884 G15H3'-A16H8 4.740 8.427 G15H4'-H1' 4.276 6.004 G15H4'-H8 4.273 7.884 G15H4'-A16H1' 4.276 6.082 G15H4'-A16H2 4.271 8.109 G15H4'-A16H8 4.275 8.427 G15H5"-G14H1' 3.960 5.917 G15H5"-H1' 3.961 6.004 G15H5"-H2' 3.961 4.306 G15H5"-H4' 3.961 4.276 G15H5"-H5' 3.962 4.368 G15H5"-H8 3.960 7.884 G15H5"-A16H1' 3.960 6.083 G15H5"-A16H8 3.960 8.427 G15H5'-G14H1' 4.365 5.917 G15H5'-H1' 4.366 6.005 G15H5'-H8 4.367 7.884 G15H5'-A16H8 4.370 8.427 G15H8-H8 7.884 7.885 G15H8-A16H8 7.885 8.426 A16H1'-H1' 6.082 6.081 A16H1'-H2 6.082 8.108 A16H1'-H8 6.082 8.427 A16H2-H2 8.109 8.109 A16H2'-G15H1' 4.828 6.006 A16H2'-H1' 4.824 6.082 A16H2'-H2 4.825 8.109 A16H2'-H8 4.824 8.427 A16H2'-U17H6 4.826 7.938 A16H2'-U19H5 4.828 5.705 A16H3'-G15H1' 4.778 6.005 A16H3'-H1' 4.779 6.082 A16H3'-H8 4.779 8.427 A16H3'-U17H6 4.779 7.938 A16H4'-H1' 4.558 6.082 A16H4'-H8 4.557 8.427 A16H4'-U17H6 4.559 7.937 A16H5"-G15H1' 4.134 6.005 A16H5"-H1' 4.135 6.083 A16H5"-H4' 4.136 4.561 A16H5"-H5' 4.136 4.321 A16H5"-H8 4.135 8.427 A16H5"-U17H6 4.137 7.938 A16H5'-H1' 4.322 6.082 A16H5'-H8 4.318 8.427 A16H5'-U17H6 4.319 7.938 A16H8-H8 8.426 8.427 U17H1'-H1' 6.045 6.045 U17H1'-H6 6.045 7.937 U17H2'-H1' 4.480 6.043 U17H2'-H6 4.479 7.937 U17H3'-A16H1' 4.675 6.082 U17H3'-H1' 4.675 6.044 U17H3'-H6 4.676 7.938 U17H4'-H1' 4.510 6.043 U17H4'-H6 4.511 7.937 U17H5-A16H1' 5.932 6.081 U17H5-H5 5.931 5.931 U17H5-H6 5.932 7.937 U17H5"-A16H1' 4.203 6.082 U17H5"-H1' 4.204 6.044 U17H5"-H4' 4.203 4.511 U17H5"-H6 4.200 7.938 U17H5'-H1' 4.265 6.044 U17H5'-H6 4.264 7.938 U17H6-A16H8 7.941 8.425 U17H6-H6 7.937 7.937 C18H1'-A16H2 5.939 8.109 C18H1'-H1' 5.941 5.941 C18H1'-H6 5.939 7.841 C18H2'-A16H8 4.405 8.427 C18H2'-H1' 4.403 5.940 C18H2'-H6 4.402 7.840 C18H2'-U19H5 4.401 5.706 C18H2'-U19H6 4.400 7.818 C18H3'-H1' 4.620 5.938 C18H3'-H6 4.620 7.840 C18H3'-U19H5 4.617 5.706 C18H3'-U19H6 4.620 7.819 C18H4'-H1' 4.447 5.940 C18H4'-H6 4.447 7.840 C18H4'-U19H5 4.448 5.706 C18H5-H5 6.019 6.018 C18H5-H6 6.020 7.841 C18H5"-H1' 4.158 5.940 C18H5"-H6 4.159 7.840 C18H5'-H1' 4.246 5.939 C18H5'-H4' 4.244 4.447 C18H5'-H6 4.245 7.840 C18H6-A16H2 7.839 8.110 C18H6-H6 7.840 7.841 U19H1'-A16H8 5.940 8.427 U19H1'-H1' 5.943 5.943 U19H1'-H6 5.944 7.818 U19H1'-G20H8 5.943 8.074 U19H2'-A16H2 4.487 8.109 U19H2'-A16H8 4.488 8.427 U19H2'-H1' 4.487 5.943 U19H2'-H5 4.492 5.705 U19H2'-H6 4.492 7.818 U19H2'-G20H8 4.489 8.074 U19H3'-H1' 4.778 5.943 U19H3'-H5 4.777 5.705 U19H3'-H6 4.779 7.819 U19H3'-G20H8 4.779 8.075 U19H4'-H1' 4.480 5.943 U19H4'-H6 4.482 7.818 U19H5-A16H1' 5.706 6.082 U19H5-A16H8 5.705 8.427 U19H5-C18H1' 5.704 5.943 U19H5-H5 5.705 5.704 U19H5-H6 5.706 7.818 U19H5"-H1' 4.175 5.943 U19H5"-H4' 4.175 4.482 U19H5"-H6 4.175 7.819 U19H5'-H1' 4.271 5.942 U19H5'-H4' 4.270 4.482 U19H5'-H5 4.272 5.705 U19H5'-H6 4.271 7.819 U19H6-A16H8 7.820 8.426 U19H6-H6 7.818 7.818 G20H1'-H1' 5.818 5.817 G20H1'-H8 5.817 8.074 G20H1'-G21H1' 5.817 6.029 G20H1'-G21H8 5.817 7.968 G20H2'-H1' 4.959 5.817 G20H2'-H8 4.957 8.074 G20H2'-G21H1' 4.957 6.026 G20H2'-G21H8 4.956 7.967 G20H3'-H1' 4.736 5.817 G20H3'-H8 4.736 8.074 G20H3'-G21H8 4.733 7.967 G20H4'-H1' 4.595 5.817 G20H4'-H8 4.593 8.074 G20H4'-G21H8 4.592 7.969 G20H5"-H1' 4.288 5.817 G20H5"-H8 4.288 8.074 G20H5"-G21H8 4.287 7.969 G20H5'-H1' 4.340 5.817 G20H5'-H8 4.340 8.074 G20H8-H8 8.074 8.073 G21H1'-G1H8 6.027 8.120 G21H1'-H1' 6.028 6.028 G21H1'-H8 6.027 7.968 G21H1'-G22H8 6.027 7.845 G21H2'-H1' 4.501 6.027 G21H2'-H8 4.503 7.969 G21H2'-G22H1' 4.503 6.117 G21H2'-G22H8 4.504 7.845 G21H3'-H1' 4.800 6.027 G21H3'-H8 4.802 7.968 G21H3'-G22H8 4.801 7.845 G21H4'-H1' 4.620 6.027 G21H4'-H8 4.621 7.969 G21H5"-G20H1' 4.459 5.816 G21H5"-H1' 4.459 6.027 G21H5"-H8 4.462 7.969 G21H5'-H1' 4.558 6.027 G21H5'-H8 4.557 7.968 G21H8-G20H8 7.966 8.075 G21H8-H8 7.971 7.968 G22H1'-H1' 6.117 6.117 G22H1'-H8 6.118 7.845 G22H2'-H1' 4.199 6.116 G22H2'-H3' 4.198 4.464 G22H2'-H8 4.200 7.845 G22H3'-H1' 4.465 6.117 G22H3'-H8 4.465 7.845 G22H4'-H1' 4.371 6.117 G22H4'-H3' 4.372 4.465 G22H4'-H8 4.371 7.845 G22H5"-G21H1' 4.137 6.027 G22H5"-H1' 4.136 6.117 G22H5"-H4' 4.137 4.371 G22H5"-H8 4.136 7.844 G22H5'-H1' 4.648 6.117 G22H5'-H8 4.645 7.845 G22H8-G21H8 7.845 7.967 G22H8-H8 7.845 7.845 ; loop_ _Spectral_dim.ID _Spectral_dim.Axis_code _Spectral_dim.Spectrometer_frequency _Spectral_dim.Atom_type _Spectral_dim.Atom_isotope_number _Spectral_dim.Spectral_region _Spectral_dim.Magnetization_linkage_ID _Spectral_dim.Under_sampling_type _Spectral_dim.Sweep_width _Spectral_dim.Sweep_width_units _Spectral_dim.Value_first_point _Spectral_dim.Absolute_peak_positions _Spectral_dim.Acquisition _Spectral_dim.Center_frequency_offset _Spectral_dim.Encoding_code _Spectral_dim.Encoded_reduced_dimension_ID _Spectral_dim.Entry_ID _Spectral_dim.Spectral_peak_list_ID 1 . . H 1 H . . 8196.722 Hz . . . 6301.26 . . 34676 1 2 . . H 1 H . . 8196.753 Hz . . . 6301.26 . . 34676 1 stop_ loop_ _Spectral_peak_software.Software_ID _Spectral_peak_software.Software_label _Spectral_peak_software.Method_ID _Spectral_peak_software.Method_label _Spectral_peak_software.Entry_ID _Spectral_peak_software.Spectral_peak_list_ID 2 $software_2 . . 34676 1 stop_ save_