data_34685 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34685 _Entry.Title ; Solution structure of a lanthanide-binding DNA aptamer ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-11-18 _Entry.Accession_date 2021-11-18 _Entry.Last_release_date 2021-11-22 _Entry.Original_release_date 2021-11-22 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 W. Andralojc W. . . . 34685 2 Z. Gdaniec Z. . . . 34685 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 34685 aptamer . 34685 lanthanide . 34685 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 6 34685 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 779 34685 '31P chemical shifts' 79 34685 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2023-02-10 2021-11-18 update BMRB 'update entry citation' 34685 1 . . 2021-11-28 2021-11-18 original author 'original release' 34685 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 7QB3 'BMRB Entry Tracking System' 34685 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34685 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 36043489 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution Structure of a Lanthanide-binding DNA Aptamer Determined Using High Quality pseudocontact shift restraints ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Chemistry _Citation.Journal_name_full 'Chemistry (Weinheim an der Bergstrasse, Germany)' _Citation.Journal_volume 28 _Citation.Journal_issue 66 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1521-3765 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first e202202114 _Citation.Page_last e202202114 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 W. Andralojc W. . . . 34685 1 2 J. Wieruszewska J. . . . 34685 1 3 K. Pasternak K. . . . 34685 1 4 Z. Gdaniec Z. . . . 34685 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34685 _Assembly.ID 1 _Assembly.Name 'Lanthanide-binding aptamer' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34685 1 2 unit_2 2 $entity_LU B A no . . . . . . 34685 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34685 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; CGGCCGTCGAAGACCCGCGA AGTGGCCG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 28 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 8642.544 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DC . 34685 1 2 . DG . 34685 1 3 . DG . 34685 1 4 . DC . 34685 1 5 . DC . 34685 1 6 . DG . 34685 1 7 . DT . 34685 1 8 . DC . 34685 1 9 . DG . 34685 1 10 . DA . 34685 1 11 . DA . 34685 1 12 . DG . 34685 1 13 . DA . 34685 1 14 . DC . 34685 1 15 . DC . 34685 1 16 . DC . 34685 1 17 . DG . 34685 1 18 . DC . 34685 1 19 . DG . 34685 1 20 . DA . 34685 1 21 . DA . 34685 1 22 . DG . 34685 1 23 . DT . 34685 1 24 . DG . 34685 1 25 . DG . 34685 1 26 . DC . 34685 1 27 . DC . 34685 1 28 . DG . 34685 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DC 1 1 34685 1 . DG 2 2 34685 1 . DG 3 3 34685 1 . DC 4 4 34685 1 . DC 5 5 34685 1 . DG 6 6 34685 1 . DT 7 7 34685 1 . DC 8 8 34685 1 . DG 9 9 34685 1 . DA 10 10 34685 1 . DA 11 11 34685 1 . DG 12 12 34685 1 . DA 13 13 34685 1 . DC 14 14 34685 1 . DC 15 15 34685 1 . DC 16 16 34685 1 . DG 17 17 34685 1 . DC 18 18 34685 1 . DG 19 19 34685 1 . DA 20 20 34685 1 . DA 21 21 34685 1 . DG 22 22 34685 1 . DT 23 23 34685 1 . DG 24 24 34685 1 . DG 25 25 34685 1 . DC 26 26 34685 1 . DC 27 27 34685 1 . DG 28 28 34685 1 stop_ save_ save_entity_LU _Entity.Sf_category entity _Entity.Sf_framecode entity_LU _Entity.Entry_ID 34685 _Entity.ID 2 _Entity.BMRB_code LU _Entity.Name entity_LU _Entity.Type non-polymer _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID LU _Entity.Nonpolymer_comp_label $chem_comp_LU _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic . _Entity.Thiol_state . _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 174.967 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'LUTETIUM (III) ION' BMRB 34685 2 stop_ loop_ _Entity_systematic_name.Name _Entity_systematic_name.Naming_system _Entity_systematic_name.Entry_ID _Entity_systematic_name.Entity_ID 'LUTETIUM (III) ION' BMRB 34685 2 LU 'Three letter code' 34685 2 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 LU $chem_comp_LU 34685 2 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34685 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32630 'no natural source' . 'synthetic construct' . . . . . synthetic construct . . . . . . . . . . . . . 34685 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34685 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34685 1 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_LU _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_LU _Chem_comp.Entry_ID 34685 _Chem_comp.ID LU _Chem_comp.Provenance PDB _Chem_comp.Name 'LUTETIUM (III) ION' _Chem_comp.Type NON-POLYMER _Chem_comp.BMRB_code LU _Chem_comp.PDB_code LU _Chem_comp.Ambiguous_flag no _Chem_comp.Initial_date 2020-07-10 _Chem_comp.Modified_date 2020-07-10 _Chem_comp.Release_status REL _Chem_comp.Replaced_by . _Chem_comp.Replaces . _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code LU _Chem_comp.Number_atoms_all 1 _Chem_comp.Number_atoms_nh 1 _Chem_comp.Atom_nomenclature_source . _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code InChI=1S/Lu/q+3 _Chem_comp.Mon_nstd_flag no _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms LU _Chem_comp.Formal_charge 3 _Chem_comp.Paramagnetic . _Chem_comp.Aromatic no _Chem_comp.Formula Lu _Chem_comp.Formula_weight 174.967 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag no _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag no _Chem_comp.Model_coordinates_db_code . _Chem_comp.Processing_site RCSB _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . loop_ _Chem_comp_descriptor.Descriptor _Chem_comp_descriptor.Type _Chem_comp_descriptor.Program _Chem_comp_descriptor.Program_version _Chem_comp_descriptor.Entry_ID _Chem_comp_descriptor.Comp_ID InChI=1S/Lu/q+3 InChI InChI 1.03 34685 LU PSDMOPINLDTFSZ-UHFFFAOYSA-N InChIKey InChI 1.03 34685 LU [Lu+3] SMILES ACDLabs 10.04 34685 LU [Lu+3] SMILES CACTVS 3.341 34685 LU [Lu+3] SMILES 'OpenEye OEToolkits' 1.5.0 34685 LU [Lu+3] SMILES_CANONICAL CACTVS 3.341 34685 LU [Lu+3] SMILES_CANONICAL 'OpenEye OEToolkits' 1.5.0 34685 LU stop_ loop_ _Chem_comp_identifier.Identifier _Chem_comp_identifier.Type _Chem_comp_identifier.Program _Chem_comp_identifier.Program_version _Chem_comp_identifier.Entry_ID _Chem_comp_identifier.Comp_ID lutetium 'SYSTEMATIC NAME' ACDLabs 10.04 34685 LU 'lutetium(+3) cation' 'SYSTEMATIC NAME' 'OpenEye OEToolkits' 1.5.0 34685 LU stop_ loop_ _Chem_comp_atom.Atom_ID _Chem_comp_atom.BMRB_code _Chem_comp_atom.PDB_atom_ID _Chem_comp_atom.Alt_atom_ID _Chem_comp_atom.Auth_atom_ID _Chem_comp_atom.Type_symbol _Chem_comp_atom.Isotope_number _Chem_comp_atom.Chirality _Chem_comp_atom.Stereo_config _Chem_comp_atom.Charge _Chem_comp_atom.Partial_charge _Chem_comp_atom.Oxidation_number _Chem_comp_atom.Unpaired_electron_number _Chem_comp_atom.Align _Chem_comp_atom.Aromatic_flag _Chem_comp_atom.Leaving_atom_flag _Chem_comp_atom.Substruct_code _Chem_comp_atom.Ionizable _Chem_comp_atom.Drawing_2D_coord_x _Chem_comp_atom.Drawing_2D_coord_y _Chem_comp_atom.Model_Cartn_x _Chem_comp_atom.Model_Cartn_x_esd _Chem_comp_atom.Model_Cartn_y _Chem_comp_atom.Model_Cartn_y_esd _Chem_comp_atom.Model_Cartn_z _Chem_comp_atom.Model_Cartn_z_esd _Chem_comp_atom.Model_Cartn_x_ideal _Chem_comp_atom.Model_Cartn_y_ideal _Chem_comp_atom.Model_Cartn_z_ideal _Chem_comp_atom.PDBX_ordinal _Chem_comp_atom.Details _Chem_comp_atom.Entry_ID _Chem_comp_atom.Comp_ID LU LU LU LU . LU . . N 3 . . . 0 N N . . . . 0.000 . 0.000 . 0.000 . 0.000 0.000 0.000 1 . 34685 LU stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34685 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM Lutetium chloride, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 1 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 1 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 1 4 'Lutetium chloride' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34685 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM Europium chloride, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 2 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 2 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 2 4 'Europium chloride' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 34685 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM Ytterbium acetate, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 3 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 3 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 3 4 'Ytterbium acetate' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 34685 _Sample.ID 4 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM cerium chloride, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 4 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 4 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 4 4 'cerium chloride' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 34685 _Sample.ID 5 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM thulium chloride, 100% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 5 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 5 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 5 4 'thulium chloride' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 5 stop_ save_ save_sample_6 _Sample.Sf_category sample _Sample.Sf_framecode sample_6 _Sample.Entry_ID 34685 _Sample.ID 6 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '700 uM Lanthanide-binding aptamer, 10 mM cacodylate, 150 mM sodium chloride, 700 uM Lutetium chloride, 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Lanthanide-binding aptamer' 'natural abundance' 1 $assembly 1 $entity_1 . . 700 . . uM 35 . . . 34685 6 2 cacodylate 'natural abundance' . . . . . . 10 . . mM 0.5 . . . 34685 6 3 'sodium chloride' 'natural abundance' . . . . . . 150 . . mM 7.5 . . . 34685 6 4 'Lutetium chloride' 'natural abundance' . . . . . . 700 . . uM 35 . . . 34685 6 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34685 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.16 . M 34685 1 pH 6.2 0.1 pH 34685 1 pressure 1 . atm 34685 1 temperature 298 . K 34685 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 34685 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.16 . M 34685 2 pH 6.2 0.1 pH 34685 2 pressure 1 . atm 34685 2 temperature 298 . K 34685 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34685 _Software.ID 1 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34685 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34685 1 'structure calculation' . 34685 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34685 _Software.ID 2 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID NMRFAM . . 34685 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34685 2 'peak picking' . 34685 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34685 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34685 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE III' . 700 . . . 34685 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34685 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 2 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 3 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 4 '2D 1H-31P COSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 5 '2D 1H-1H NOESY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 6 '2D 1H-13C HSQC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 7 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 8 '2D 1H-31P COSY' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 9 '2D NOESY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 10 '2D 1H-13C HSQC' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 11 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 12 '2D 1H-31P COSY' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 13 '2D NOESY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 14 '2D 1H-13C HSQC' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 15 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 16 '2D 1H-31P COSY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 17 '2D NOESY' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 18 '2D 1H-13C HSQC' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 19 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 20 '2D 1H-31P COSY' no . . . . . . . . . . . . 5 $sample_5 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 21 '2D NOESY' no . . . . . . . . . . . . 6 $sample_6 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 22 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 6 $sample_6 isotropic . . 1 . . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34685 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34685 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 TSP 'methyl protons' . . . . ppm 0.000 internal direct 1.00 . . . . . 34685 1 P 31 TSP 'methyl protons' . . . . ppm 0.000 internal indirect 0.404 . . . . . 34685 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D NOESY' . . . 34685 1 2 '2D 1H-13C HSQC' . . . 34685 1 3 '2D 1H-1H TOCSY' . . . 34685 1 4 '2D 1H-31P COSY' . . . 34685 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DC H1' H 1 5.752 0.01 . 1 . . . . A 1 DC H1' . 34685 1 2 . 1 . 1 1 1 DC H2' H 1 1.859 0.01 . 1 . . . . A 1 DC H2' . 34685 1 3 . 1 . 1 1 1 DC H2'' H 1 2.358 0.01 . 1 . . . . A 1 DC H2'' . 34685 1 4 . 1 . 1 1 1 DC H3' H 1 4.685 0.01 . 1 . . . . A 1 DC H3' . 34685 1 5 . 1 . 1 1 1 DC H4' H 1 4.061 0.01 . 1 . . . . A 1 DC H4' . 34685 1 6 . 1 . 1 1 1 DC H5 H 1 5.911 0.01 . 1 . . . . A 1 DC H5 . 34685 1 7 . 1 . 1 1 1 DC H5' H 1 3.699 0.01 . 2 . . . . A 1 DC H5' . 34685 1 8 . 1 . 1 1 1 DC H6 H 1 7.598 0.01 . 1 . . . . A 1 DC H6 . 34685 1 9 . 1 . 1 2 2 DG H1' H 1 5.526 0.01 . 1 . . . . A 2 DG H1' . 34685 1 10 . 1 . 1 2 2 DG H2' H 1 2.692 0.01 . 1 . . . . A 2 DG H2' . 34685 1 11 . 1 . 1 2 2 DG H2'' H 1 2.745 0.01 . 1 . . . . A 2 DG H2'' . 34685 1 12 . 1 . 1 2 2 DG H3' H 1 4.978 0.01 . 1 . . . . A 2 DG H3' . 34685 1 13 . 1 . 1 2 2 DG H4' H 1 4.313 0.01 . 1 . . . . A 2 DG H4' . 34685 1 14 . 1 . 1 2 2 DG H5' H 1 4.076 0.01 . 2 . . . . A 2 DG H5' . 34685 1 15 . 1 . 1 2 2 DG H5'' H 1 3.966 0.01 . 2 . . . . A 2 DG H5'' . 34685 1 16 . 1 . 1 2 2 DG H8 H 1 7.915 0.01 . 1 . . . . A 2 DG H8 . 34685 1 17 . 1 . 1 2 2 DG P P 31 -3.925 0.05 . 1 . . . . A 2 DG P . 34685 1 18 . 1 . 1 3 3 DG H1' H 1 5.995 0.01 . 1 . . . . A 3 DG H1' . 34685 1 19 . 1 . 1 3 3 DG H2' H 1 2.598 0.01 . 1 . . . . A 3 DG H2' . 34685 1 20 . 1 . 1 3 3 DG H2'' H 1 2.701 0.01 . 1 . . . . A 3 DG H2'' . 34685 1 21 . 1 . 1 3 3 DG H3' H 1 5.058 0.01 . 1 . . . . A 3 DG H3' . 34685 1 22 . 1 . 1 3 3 DG H4' H 1 4.473 0.01 . 1 . . . . A 3 DG H4' . 34685 1 23 . 1 . 1 3 3 DG H5'' H 1 4.160 0.01 . 2 . . . . A 3 DG H5'' . 34685 1 24 . 1 . 1 3 3 DG H8 H 1 7.812 0.01 . 1 . . . . A 3 DG H8 . 34685 1 25 . 1 . 1 3 3 DG P P 31 -3.824 0.05 . 1 . . . . A 3 DG P . 34685 1 26 . 1 . 1 4 4 DC H1' H 1 6.021 0.01 . 1 . . . . A 4 DC H1' . 34685 1 27 . 1 . 1 4 4 DC H2' H 1 1.363 0.01 . 1 . . . . A 4 DC H2' . 34685 1 28 . 1 . 1 4 4 DC H2'' H 1 2.354 0.01 . 1 . . . . A 4 DC H2'' . 34685 1 29 . 1 . 1 4 4 DC H3' H 1 4.844 0.01 . 1 . . . . A 4 DC H3' . 34685 1 30 . 1 . 1 4 4 DC H4' H 1 4.242 0.01 . 1 . . . . A 4 DC H4' . 34685 1 31 . 1 . 1 4 4 DC H5 H 1 5.272 0.01 . 1 . . . . A 4 DC H5 . 34685 1 32 . 1 . 1 4 4 DC H6 H 1 6.970 0.01 . 1 . . . . A 4 DC H6 . 34685 1 33 . 1 . 1 4 4 DC P P 31 -3.983 0.05 . 1 . . . . A 4 DC P . 34685 1 34 . 1 . 1 5 5 DC H1' H 1 6.173 0.01 . 1 . . . . A 5 DC H1' . 34685 1 35 . 1 . 1 5 5 DC H2' H 1 2.041 0.01 . 1 . . . . A 5 DC H2' . 34685 1 36 . 1 . 1 5 5 DC H2'' H 1 1.747 0.01 . 1 . . . . A 5 DC H2'' . 34685 1 37 . 1 . 1 5 5 DC H3' H 1 4.985 0.01 . 1 . . . . A 5 DC H3' . 34685 1 38 . 1 . 1 5 5 DC H4' H 1 4.171 0.01 . 1 . . . . A 5 DC H4' . 34685 1 39 . 1 . 1 5 5 DC H5 H 1 4.847 0.01 . 1 . . . . A 5 DC H5 . 34685 1 40 . 1 . 1 5 5 DC H6 H 1 7.249 0.01 . 1 . . . . A 5 DC H6 . 34685 1 41 . 1 . 1 5 5 DC P P 31 -4.292 0.05 . 1 . . . . A 5 DC P . 34685 1 42 . 1 . 1 6 6 DG H1' H 1 6.005 0.01 . 1 . . . . A 6 DG H1' . 34685 1 43 . 1 . 1 6 6 DG H2' H 1 2.795 0.01 . 1 . . . . A 6 DG H2' . 34685 1 44 . 1 . 1 6 6 DG H2'' H 1 2.891 0.01 . 1 . . . . A 6 DG H2'' . 34685 1 45 . 1 . 1 6 6 DG H3' H 1 5.066 0.01 . 1 . . . . A 6 DG H3' . 34685 1 46 . 1 . 1 6 6 DG H4' H 1 4.483 0.01 . 1 . . . . A 6 DG H4' . 34685 1 47 . 1 . 1 6 6 DG H5' H 1 4.176 0.01 . 2 . . . . A 6 DG H5' . 34685 1 48 . 1 . 1 6 6 DG H5'' H 1 4.058 0.01 . 2 . . . . A 6 DG H5'' . 34685 1 49 . 1 . 1 6 6 DG H8 H 1 8.229 0.01 . 1 . . . . A 6 DG H8 . 34685 1 50 . 1 . 1 6 6 DG P P 31 -4.604 0.05 . 1 . . . . A 6 DG P . 34685 1 51 . 1 . 1 7 7 DT H1' H 1 6.875 0.01 . 1 . . . . A 7 DT H1' . 34685 1 52 . 1 . 1 7 7 DT H2' H 1 2.127 0.01 . 1 . . . . A 7 DT H2' . 34685 1 53 . 1 . 1 7 7 DT H2'' H 1 2.551 0.01 . 1 . . . . A 7 DT H2'' . 34685 1 54 . 1 . 1 7 7 DT H3' H 1 4.979 0.01 . 1 . . . . A 7 DT H3' . 34685 1 55 . 1 . 1 7 7 DT H4' H 1 4.474 0.01 . 1 . . . . A 7 DT H4' . 34685 1 56 . 1 . 1 7 7 DT H6 H 1 7.417 0.01 . 1 . . . . A 7 DT H6 . 34685 1 57 . 1 . 1 7 7 DT H71 H 1 1.403 0.01 . 3 . . . . A 7 DT H71 . 34685 1 58 . 1 . 1 7 7 DT H72 H 1 1.403 0.01 . 3 . . . . A 7 DT H72 . 34685 1 59 . 1 . 1 7 7 DT H73 H 1 1.403 0.01 . 3 . . . . A 7 DT H73 . 34685 1 60 . 1 . 1 7 7 DT P P 31 -4.266 0.05 . 1 . . . . A 7 DT P . 34685 1 61 . 1 . 1 8 8 DC H1' H 1 5.994 0.01 . 1 . . . . A 8 DC H1' . 34685 1 62 . 1 . 1 8 8 DC H2' H 1 1.870 0.01 . 1 . . . . A 8 DC H2' . 34685 1 63 . 1 . 1 8 8 DC H3' H 1 4.870 0.01 . 1 . . . . A 8 DC H3' . 34685 1 64 . 1 . 1 8 8 DC H4' H 1 4.251 0.01 . 1 . . . . A 8 DC H4' . 34685 1 65 . 1 . 1 8 8 DC H5 H 1 5.350 0.01 . 1 . . . . A 8 DC H5 . 34685 1 66 . 1 . 1 8 8 DC H5' H 1 4.138 0.01 . 2 . . . . A 8 DC H5' . 34685 1 67 . 1 . 1 8 8 DC H6 H 1 7.229 0.01 . 1 . . . . A 8 DC H6 . 34685 1 68 . 1 . 1 8 8 DC P P 31 -4.168 0.05 . 1 . . . . A 8 DC P . 34685 1 69 . 1 . 1 9 9 DG H1' H 1 5.342 0.01 . 1 . . . . A 9 DG H1' . 34685 1 70 . 1 . 1 9 9 DG H2' H 1 2.726 0.01 . 1 . . . . A 9 DG H2' . 34685 1 71 . 1 . 1 9 9 DG H2'' H 1 2.566 0.01 . 1 . . . . A 9 DG H2'' . 34685 1 72 . 1 . 1 9 9 DG H3' H 1 4.935 0.01 . 1 . . . . A 9 DG H3' . 34685 1 73 . 1 . 1 9 9 DG H4' H 1 4.535 0.01 . 1 . . . . A 9 DG H4' . 34685 1 74 . 1 . 1 9 9 DG H5'' H 1 4.175 0.01 . 2 . . . . A 9 DG H5'' . 34685 1 75 . 1 . 1 9 9 DG H8 H 1 8.160 0.01 . 1 . . . . A 9 DG H8 . 34685 1 76 . 1 . 1 9 9 DG P P 31 -4.716 0.05 . 1 . . . . A 9 DG P . 34685 1 77 . 1 . 1 10 10 DA H1' H 1 5.976 0.01 . 1 . . . . A 10 DA H1' . 34685 1 78 . 1 . 1 10 10 DA H2' H 1 2.269 0.01 . 1 . . . . A 10 DA H2' . 34685 1 79 . 1 . 1 10 10 DA H2'' H 1 2.326 0.01 . 1 . . . . A 10 DA H2'' . 34685 1 80 . 1 . 1 10 10 DA H3' H 1 4.590 0.01 . 1 . . . . A 10 DA H3' . 34685 1 81 . 1 . 1 10 10 DA H4' H 1 2.088 0.01 . 1 . . . . A 10 DA H4' . 34685 1 82 . 1 . 1 10 10 DA H5' H 1 3.401 0.01 . 2 . . . . A 10 DA H5' . 34685 1 83 . 1 . 1 10 10 DA H5'' H 1 3.124 0.01 . 2 . . . . A 10 DA H5'' . 34685 1 84 . 1 . 1 10 10 DA H8 H 1 8.159 0.01 . 1 . . . . A 10 DA H8 . 34685 1 85 . 1 . 1 11 11 DA H1' H 1 6.244 0.01 . 1 . . . . A 11 DA H1' . 34685 1 86 . 1 . 1 11 11 DA H2' H 1 2.936 0.01 . 1 . . . . A 11 DA H2' . 34685 1 87 . 1 . 1 11 11 DA H2'' H 1 2.843 0.01 . 1 . . . . A 11 DA H2'' . 34685 1 88 . 1 . 1 11 11 DA H3' H 1 4.857 0.01 . 1 . . . . A 11 DA H3' . 34685 1 89 . 1 . 1 11 11 DA H4' H 1 4.367 0.01 . 1 . . . . A 11 DA H4' . 34685 1 90 . 1 . 1 11 11 DA H5' H 1 4.012 0.01 . 2 . . . . A 11 DA H5' . 34685 1 91 . 1 . 1 11 11 DA H5'' H 1 3.858 0.01 . 2 . . . . A 11 DA H5'' . 34685 1 92 . 1 . 1 11 11 DA H8 H 1 7.968 0.01 . 1 . . . . A 11 DA H8 . 34685 1 93 . 1 . 1 11 11 DA P P 31 -4.515 0.05 . 1 . . . . A 11 DA P . 34685 1 94 . 1 . 1 12 12 DG H1' H 1 5.117 0.01 . 1 . . . . A 12 DG H1' . 34685 1 95 . 1 . 1 12 12 DG H2' H 1 2.736 0.01 . 1 . . . . A 12 DG H2' . 34685 1 96 . 1 . 1 12 12 DG H2'' H 1 2.654 0.01 . 1 . . . . A 12 DG H2'' . 34685 1 97 . 1 . 1 12 12 DG H3' H 1 4.971 0.01 . 1 . . . . A 12 DG H3' . 34685 1 98 . 1 . 1 12 12 DG H4' H 1 4.416 0.01 . 1 . . . . A 12 DG H4' . 34685 1 99 . 1 . 1 12 12 DG H5' H 1 4.291 0.01 . 2 . . . . A 12 DG H5' . 34685 1 100 . 1 . 1 12 12 DG H5'' H 1 4.156 0.01 . 2 . . . . A 12 DG H5'' . 34685 1 101 . 1 . 1 12 12 DG H8 H 1 8.102 0.01 . 1 . . . . A 12 DG H8 . 34685 1 102 . 1 . 1 12 12 DG P P 31 -4.913 0.05 . 1 . . . . A 12 DG P . 34685 1 103 . 1 . 1 13 13 DA H1' H 1 6.521 0.01 . 1 . . . . A 13 DA H1' . 34685 1 104 . 1 . 1 13 13 DA H2 H 1 8.124 0.01 . 1 . . . . A 13 DA H2 . 34685 1 105 . 1 . 1 13 13 DA H2' H 1 2.788 0.01 . 1 . . . . A 13 DA H2' . 34685 1 106 . 1 . 1 13 13 DA H2'' H 1 3.155 0.01 . 1 . . . . A 13 DA H2'' . 34685 1 107 . 1 . 1 13 13 DA H3' H 1 5.160 0.01 . 1 . . . . A 13 DA H3' . 34685 1 108 . 1 . 1 13 13 DA H4' H 1 4.601 0.01 . 1 . . . . A 13 DA H4' . 34685 1 109 . 1 . 1 13 13 DA H5' H 1 4.283 0.01 . 2 . . . . A 13 DA H5' . 34685 1 110 . 1 . 1 13 13 DA H5'' H 1 4.186 0.01 . 2 . . . . A 13 DA H5'' . 34685 1 111 . 1 . 1 13 13 DA H8 H 1 8.367 0.01 . 1 . . . . A 13 DA H8 . 34685 1 112 . 1 . 1 13 13 DA P P 31 -3.129 0.05 . 1 . . . . A 13 DA P . 34685 1 113 . 1 . 1 14 14 DC H1' H 1 6.139 0.01 . 1 . . . . A 14 DC H1' . 34685 1 114 . 1 . 1 14 14 DC H2' H 1 2.045 0.01 . 1 . . . . A 14 DC H2' . 34685 1 115 . 1 . 1 14 14 DC H2'' H 1 2.852 0.01 . 1 . . . . A 14 DC H2'' . 34685 1 116 . 1 . 1 14 14 DC H3' H 1 5.002 0.01 . 1 . . . . A 14 DC H3' . 34685 1 117 . 1 . 1 14 14 DC H4' H 1 4.347 0.01 . 1 . . . . A 14 DC H4' . 34685 1 118 . 1 . 1 14 14 DC H5 H 1 5.270 0.01 . 1 . . . . A 14 DC H5 . 34685 1 119 . 1 . 1 14 14 DC H6 H 1 7.324 0.01 . 1 . . . . A 14 DC H6 . 34685 1 120 . 1 . 1 14 14 DC P P 31 -4.280 0.05 . 1 . . . . A 14 DC P . 34685 1 121 . 1 . 1 15 15 DC H1' H 1 6.417 0.01 . 1 . . . . A 15 DC H1' . 34685 1 122 . 1 . 1 15 15 DC H2' H 1 2.137 0.01 . 2 . . . . A 15 DC H2' . 34685 1 123 . 1 . 1 15 15 DC H2'' H 1 3.137 0.01 . 2 . . . . A 15 DC H2'' . 34685 1 124 . 1 . 1 15 15 DC H3' H 1 4.674 0.01 . 1 . . . . A 15 DC H3' . 34685 1 125 . 1 . 1 15 15 DC H4' H 1 4.527 0.01 . 1 . . . . A 15 DC H4' . 34685 1 126 . 1 . 1 15 15 DC H5 H 1 6.422 0.01 . 1 . . . . A 15 DC H5 . 34685 1 127 . 1 . 1 15 15 DC H5'' H 1 4.269 0.01 . 2 . . . . A 15 DC H5'' . 34685 1 128 . 1 . 1 15 15 DC H6 H 1 8.505 0.01 . 1 . . . . A 15 DC H6 . 34685 1 129 . 1 . 1 15 15 DC P P 31 -3.343 0.05 . 1 . . . . A 15 DC P . 34685 1 130 . 1 . 1 16 16 DC H1' H 1 5.505 0.01 . 1 . . . . A 16 DC H1' . 34685 1 131 . 1 . 1 16 16 DC H2' H 1 2.295 0.01 . 2 . . . . A 16 DC H2' . 34685 1 132 . 1 . 1 16 16 DC H2'' H 1 1.570 0.01 . 2 . . . . A 16 DC H2'' . 34685 1 133 . 1 . 1 16 16 DC H3' H 1 4.825 0.01 . 1 . . . . A 16 DC H3' . 34685 1 134 . 1 . 1 16 16 DC H4' H 1 3.713 0.01 . 1 . . . . A 16 DC H4' . 34685 1 135 . 1 . 1 16 16 DC H5 H 1 6.046 0.01 . 1 . . . . A 16 DC H5 . 34685 1 136 . 1 . 1 16 16 DC H5' H 1 3.614 0.01 . 2 . . . . A 16 DC H5' . 34685 1 137 . 1 . 1 16 16 DC H5'' H 1 3.559 0.01 . 2 . . . . A 16 DC H5'' . 34685 1 138 . 1 . 1 16 16 DC H6 H 1 7.595 0.01 . 1 . . . . A 16 DC H6 . 34685 1 139 . 1 . 1 16 16 DC P P 31 -3.320 0.05 . 1 . . . . A 16 DC P . 34685 1 140 . 1 . 1 17 17 DG H1' H 1 5.552 0.01 . 1 . . . . A 17 DG H1' . 34685 1 141 . 1 . 1 17 17 DG H2' H 1 2.511 0.01 . 2 . . . . A 17 DG H2' . 34685 1 142 . 1 . 1 17 17 DG H2'' H 1 2.389 0.01 . 2 . . . . A 17 DG H2'' . 34685 1 143 . 1 . 1 17 17 DG H3' H 1 4.316 0.01 . 1 . . . . A 17 DG H3' . 34685 1 144 . 1 . 1 17 17 DG H4' H 1 3.891 0.01 . 1 . . . . A 17 DG H4' . 34685 1 145 . 1 . 1 17 17 DG H8 H 1 7.488 0.01 . 1 . . . . A 17 DG H8 . 34685 1 146 . 1 . 1 17 17 DG P P 31 -6.659 0.05 . 1 . . . . A 17 DG P . 34685 1 147 . 1 . 1 18 18 DC H1' H 1 6.038 0.01 . 1 . . . . A 18 DC H1' . 34685 1 148 . 1 . 1 18 18 DC H2' H 1 1.421 0.01 . 1 . . . . A 18 DC H2' . 34685 1 149 . 1 . 1 18 18 DC H2'' H 1 2.449 0.01 . 1 . . . . A 18 DC H2'' . 34685 1 150 . 1 . 1 18 18 DC H3' H 1 4.728 0.01 . 1 . . . . A 18 DC H3' . 34685 1 151 . 1 . 1 18 18 DC H4' H 1 4.258 0.01 . 1 . . . . A 18 DC H4' . 34685 1 152 . 1 . 1 18 18 DC H5 H 1 4.888 0.01 . 1 . . . . A 18 DC H5 . 34685 1 153 . 1 . 1 18 18 DC H5' H 1 4.015 0.01 . 2 . . . . A 18 DC H5' . 34685 1 154 . 1 . 1 18 18 DC H5'' H 1 3.848 0.01 . 2 . . . . A 18 DC H5'' . 34685 1 155 . 1 . 1 18 18 DC H6 H 1 6.818 0.01 . 1 . . . . A 18 DC H6 . 34685 1 156 . 1 . 1 18 18 DC P P 31 -9.983 0.05 . 1 . . . . A 18 DC P . 34685 1 157 . 1 . 1 19 19 DG H1' H 1 5.563 0.01 . 1 . . . . A 19 DG H1' . 34685 1 158 . 1 . 1 19 19 DG H2' H 1 2.627 0.01 . 2 . . . . A 19 DG H2' . 34685 1 159 . 1 . 1 19 19 DG H3' H 1 4.944 0.01 . 1 . . . . A 19 DG H3' . 34685 1 160 . 1 . 1 19 19 DG H4' H 1 4.444 0.01 . 1 . . . . A 19 DG H4' . 34685 1 161 . 1 . 1 19 19 DG H5'' H 1 4.030 0.01 . 2 . . . . A 19 DG H5'' . 34685 1 162 . 1 . 1 19 19 DG H8 H 1 8.161 0.01 . 1 . . . . A 19 DG H8 . 34685 1 163 . 1 . 1 19 19 DG P P 31 -4.432 0.05 . 1 . . . . A 19 DG P . 34685 1 164 . 1 . 1 20 20 DA H1' H 1 6.031 0.01 . 1 . . . . A 20 DA H1' . 34685 1 165 . 1 . 1 20 20 DA H2 H 1 8.102 0.01 . 1 . . . . A 20 DA H2 . 34685 1 166 . 1 . 1 20 20 DA H2' H 1 2.255 0.01 . 1 . . . . A 20 DA H2' . 34685 1 167 . 1 . 1 20 20 DA H2'' H 1 2.343 0.01 . 1 . . . . A 20 DA H2'' . 34685 1 168 . 1 . 1 20 20 DA H3' H 1 4.599 0.01 . 1 . . . . A 20 DA H3' . 34685 1 169 . 1 . 1 20 20 DA H4' H 1 2.193 0.01 . 1 . . . . A 20 DA H4' . 34685 1 170 . 1 . 1 20 20 DA H5' H 1 3.416 0.01 . 2 . . . . A 20 DA H5' . 34685 1 171 . 1 . 1 20 20 DA H5'' H 1 3.071 0.01 . 2 . . . . A 20 DA H5'' . 34685 1 172 . 1 . 1 20 20 DA H8 H 1 8.026 0.01 . 1 . . . . A 20 DA H8 . 34685 1 173 . 1 . 1 21 21 DA H1' H 1 6.424 0.01 . 1 . . . . A 21 DA H1' . 34685 1 174 . 1 . 1 21 21 DA H2' H 1 2.730 0.01 . 1 . . . . A 21 DA H2' . 34685 1 175 . 1 . 1 21 21 DA H2'' H 1 3.009 0.01 . 1 . . . . A 21 DA H2'' . 34685 1 176 . 1 . 1 21 21 DA H3' H 1 4.875 0.01 . 1 . . . . A 21 DA H3' . 34685 1 177 . 1 . 1 21 21 DA H4' H 1 4.401 0.01 . 1 . . . . A 21 DA H4' . 34685 1 178 . 1 . 1 21 21 DA H5' H 1 4.013 0.01 . 2 . . . . A 21 DA H5' . 34685 1 179 . 1 . 1 21 21 DA H5'' H 1 3.773 0.01 . 2 . . . . A 21 DA H5'' . 34685 1 180 . 1 . 1 21 21 DA H8 H 1 8.079 0.01 . 1 . . . . A 21 DA H8 . 34685 1 181 . 1 . 1 21 21 DA P P 31 -4.559 0.05 . 1 . . . . A 21 DA P . 34685 1 182 . 1 . 1 22 22 DG H1' H 1 5.788 0.01 . 1 . . . . A 22 DG H1' . 34685 1 183 . 1 . 1 22 22 DG H2' H 1 2.536 0.01 . 1 . . . . A 22 DG H2' . 34685 1 184 . 1 . 1 22 22 DG H2'' H 1 2.840 0.01 . 1 . . . . A 22 DG H2'' . 34685 1 185 . 1 . 1 22 22 DG H3' H 1 4.937 0.01 . 1 . . . . A 22 DG H3' . 34685 1 186 . 1 . 1 22 22 DG H4' H 1 4.453 0.01 . 1 . . . . A 22 DG H4' . 34685 1 187 . 1 . 1 22 22 DG H5' H 1 4.367 0.01 . 2 . . . . A 22 DG H5' . 34685 1 188 . 1 . 1 22 22 DG H5'' H 1 4.197 0.01 . 2 . . . . A 22 DG H5'' . 34685 1 189 . 1 . 1 22 22 DG H8 H 1 8.072 0.01 . 1 . . . . A 22 DG H8 . 34685 1 190 . 1 . 1 22 22 DG P P 31 -4.841 0.05 . 1 . . . . A 22 DG P . 34685 1 191 . 1 . 1 23 23 DT H1' H 1 5.901 0.01 . 1 . . . . A 23 DT H1' . 34685 1 192 . 1 . 1 23 23 DT H2' H 1 2.252 0.01 . 1 . . . . A 23 DT H2' . 34685 1 193 . 1 . 1 23 23 DT H2'' H 1 2.547 0.01 . 1 . . . . A 23 DT H2'' . 34685 1 194 . 1 . 1 23 23 DT H3' H 1 4.753 0.01 . 1 . . . . A 23 DT H3' . 34685 1 195 . 1 . 1 23 23 DT H4' H 1 4.345 0.01 . 1 . . . . A 23 DT H4' . 34685 1 196 . 1 . 1 23 23 DT H5'' H 1 4.088 0.01 . 2 . . . . A 23 DT H5'' . 34685 1 197 . 1 . 1 23 23 DT H6 H 1 7.224 0.01 . 1 . . . . A 23 DT H6 . 34685 1 198 . 1 . 1 23 23 DT H71 H 1 1.628 0.01 . 3 . . . . A 23 DT H71 . 34685 1 199 . 1 . 1 23 23 DT H72 H 1 1.628 0.01 . 3 . . . . A 23 DT H72 . 34685 1 200 . 1 . 1 23 23 DT H73 H 1 1.628 0.01 . 3 . . . . A 23 DT H73 . 34685 1 201 . 1 . 1 23 23 DT P P 31 -4.477 0.05 . 1 . . . . A 23 DT P . 34685 1 202 . 1 . 1 24 24 DG H1' H 1 5.822 0.01 . 1 . . . . A 24 DG H1' . 34685 1 203 . 1 . 1 24 24 DG H2' H 1 2.379 0.01 . 1 . . . . A 24 DG H2' . 34685 1 204 . 1 . 1 24 24 DG H2'' H 1 2.665 0.01 . 1 . . . . A 24 DG H2'' . 34685 1 205 . 1 . 1 24 24 DG H3' H 1 4.941 0.01 . 1 . . . . A 24 DG H3' . 34685 1 206 . 1 . 1 24 24 DG H4' H 1 4.352 0.01 . 1 . . . . A 24 DG H4' . 34685 1 207 . 1 . 1 24 24 DG H8 H 1 7.605 0.01 . 1 . . . . A 24 DG H8 . 34685 1 208 . 1 . 1 24 24 DG P P 31 -3.812 0.05 . 1 . . . . A 24 DG P . 34685 1 209 . 1 . 1 25 25 DG H1' H 1 5.966 0.01 . 1 . . . . A 25 DG H1' . 34685 1 210 . 1 . 1 25 25 DG H2' H 1 2.616 0.01 . 1 . . . . A 25 DG H2' . 34685 1 211 . 1 . 1 25 25 DG H2'' H 1 2.762 0.01 . 1 . . . . A 25 DG H2'' . 34685 1 212 . 1 . 1 25 25 DG H3' H 1 5.004 0.01 . 1 . . . . A 25 DG H3' . 34685 1 213 . 1 . 1 25 25 DG H4' H 1 4.438 0.01 . 1 . . . . A 25 DG H4' . 34685 1 214 . 1 . 1 25 25 DG H8 H 1 7.815 0.01 . 1 . . . . A 25 DG H8 . 34685 1 215 . 1 . 1 25 25 DG P P 31 -4.116 0.05 . 1 . . . . A 25 DG P . 34685 1 216 . 1 . 1 26 26 DC H1' H 1 5.986 0.01 . 1 . . . . A 26 DC H1' . 34685 1 217 . 1 . 1 26 26 DC H2' H 1 2.057 0.01 . 1 . . . . A 26 DC H2' . 34685 1 218 . 1 . 1 26 26 DC H2'' H 1 2.460 0.01 . 1 . . . . A 26 DC H2'' . 34685 1 219 . 1 . 1 26 26 DC H3' H 1 4.838 0.01 . 1 . . . . A 26 DC H3' . 34685 1 220 . 1 . 1 26 26 DC H4' H 1 4.211 0.01 . 1 . . . . A 26 DC H4' . 34685 1 221 . 1 . 1 26 26 DC H5 H 1 5.295 0.01 . 1 . . . . A 26 DC H5 . 34685 1 222 . 1 . 1 26 26 DC H5'' H 1 4.170 0.01 . 2 . . . . A 26 DC H5'' . 34685 1 223 . 1 . 1 26 26 DC H6 H 1 7.363 0.01 . 1 . . . . A 26 DC H6 . 34685 1 224 . 1 . 1 26 26 DC P P 31 -4.080 0.05 . 1 . . . . A 26 DC P . 34685 1 225 . 1 . 1 27 27 DC H1' H 1 5.662 0.01 . 1 . . . . A 27 DC H1' . 34685 1 226 . 1 . 1 27 27 DC H2' H 1 2.006 0.01 . 1 . . . . A 27 DC H2' . 34685 1 227 . 1 . 1 27 27 DC H2'' H 1 2.356 0.01 . 1 . . . . A 27 DC H2'' . 34685 1 228 . 1 . 1 27 27 DC H3' H 1 4.843 0.01 . 1 . . . . A 27 DC H3' . 34685 1 229 . 1 . 1 27 27 DC H4' H 1 4.123 0.01 . 1 . . . . A 27 DC H4' . 34685 1 230 . 1 . 1 27 27 DC H5 H 1 5.666 0.01 . 1 . . . . A 27 DC H5 . 34685 1 231 . 1 . 1 27 27 DC H5'' H 1 4.095 0.01 . 2 . . . . A 27 DC H5'' . 34685 1 232 . 1 . 1 27 27 DC H6 H 1 7.482 0.01 . 1 . . . . A 27 DC H6 . 34685 1 233 . 1 . 1 27 27 DC P P 31 -4.016 0.05 . 1 . . . . A 27 DC P . 34685 1 234 . 1 . 1 28 28 DG H1' H 1 6.214 0.01 . 1 . . . . A 28 DG H1' . 34685 1 235 . 1 . 1 28 28 DG H2' H 1 2.661 0.01 . 1 . . . . A 28 DG H2' . 34685 1 236 . 1 . 1 28 28 DG H2'' H 1 2.407 0.01 . 1 . . . . A 28 DG H2'' . 34685 1 237 . 1 . 1 28 28 DG H3' H 1 4.715 0.01 . 1 . . . . A 28 DG H3' . 34685 1 238 . 1 . 1 28 28 DG H4' H 1 4.215 0.01 . 1 . . . . A 28 DG H4' . 34685 1 239 . 1 . 1 28 28 DG H5'' H 1 4.104 0.01 . 2 . . . . A 28 DG H5'' . 34685 1 240 . 1 . 1 28 28 DG H8 H 1 7.986 0.01 . 1 . . . . A 28 DG H8 . 34685 1 241 . 1 . 1 28 28 DG P P 31 -3.658 0.05 . 1 . . . . A 28 DG P . 34685 1 stop_ save_ save_assigned_chemical_shifts_2 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_2 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 5 '2D 1H-1H NOESY' . . . 34685 2 6 '2D 1H-13C HSQC' . . . 34685 2 7 '2D 1H-1H TOCSY' . . . 34685 2 8 '2D 1H-31P COSY' . . . 34685 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DC H1' H 1 5.732 0.01 . 1 . . . . A 1 DC H1' . 34685 2 2 . 1 . 1 1 1 DC H2' H 1 1.839 0.01 . 1 . . . . A 1 DC H2' . 34685 2 3 . 1 . 1 1 1 DC H2'' H 1 2.336 0.01 . 1 . . . . A 1 DC H2'' . 34685 2 4 . 1 . 1 1 1 DC H3' H 1 4.667 0.01 . 1 . . . . A 1 DC H3' . 34685 2 5 . 1 . 1 1 1 DC H4' H 1 4.048 0.01 . 1 . . . . A 1 DC H4' . 34685 2 6 . 1 . 1 1 1 DC H5 H 1 5.885 0.01 . 1 . . . . A 1 DC H5 . 34685 2 7 . 1 . 1 1 1 DC H5' H 1 3.684 0.01 . 2 . . . . A 1 DC H5' . 34685 2 8 . 1 . 1 1 1 DC H6 H 1 7.574 0.01 . 1 . . . . A 1 DC H6 . 34685 2 9 . 1 . 1 2 2 DG H1' H 1 5.492 0.01 . 1 . . . . A 2 DG H1' . 34685 2 10 . 1 . 1 2 2 DG H3' H 1 4.954 0.01 . 1 . . . . A 2 DG H3' . 34685 2 11 . 1 . 1 2 2 DG H4' H 1 4.293 0.01 . 1 . . . . A 2 DG H4' . 34685 2 12 . 1 . 1 2 2 DG H5'' H 1 3.949 0.01 . 2 . . . . A 2 DG H5'' . 34685 2 13 . 1 . 1 2 2 DG H8 H 1 7.882 0.01 . 1 . . . . A 2 DG H8 . 34685 2 14 . 1 . 1 2 2 DG P P 31 -3.946 0.05 . 1 . . . . A 2 DG P . 34685 2 15 . 1 . 1 3 3 DG H1' H 1 5.958 0.01 . 1 . . . . A 3 DG H1' . 34685 2 16 . 1 . 1 3 3 DG H2' H 1 2.571 0.01 . 1 . . . . A 3 DG H2' . 34685 2 17 . 1 . 1 3 3 DG H2'' H 1 2.649 0.01 . 1 . . . . A 3 DG H2'' . 34685 2 18 . 1 . 1 3 3 DG H3' H 1 5.037 0.01 . 1 . . . . A 3 DG H3' . 34685 2 19 . 1 . 1 3 3 DG H4' H 1 4.457 0.01 . 1 . . . . A 3 DG H4' . 34685 2 20 . 1 . 1 3 3 DG H5'' H 1 4.139 0.01 . 2 . . . . A 3 DG H5'' . 34685 2 21 . 1 . 1 3 3 DG H8 H 1 7.773 0.01 . 1 . . . . A 3 DG H8 . 34685 2 22 . 1 . 1 3 3 DG P P 31 -3.851 0.05 . 1 . . . . A 3 DG P . 34685 2 23 . 1 . 1 4 4 DC H1' H 1 6.028 0.01 . 1 . . . . A 4 DC H1' . 34685 2 24 . 1 . 1 4 4 DC H2' H 1 1.382 0.01 . 1 . . . . A 4 DC H2' . 34685 2 25 . 1 . 1 4 4 DC H2'' H 1 2.395 0.01 . 1 . . . . A 4 DC H2'' . 34685 2 26 . 1 . 1 4 4 DC H3' H 1 4.912 0.01 . 1 . . . . A 4 DC H3' . 34685 2 27 . 1 . 1 4 4 DC H4' H 1 4.274 0.01 . 1 . . . . A 4 DC H4' . 34685 2 28 . 1 . 1 4 4 DC H5 H 1 5.188 0.01 . 1 . . . . A 4 DC H5 . 34685 2 29 . 1 . 1 4 4 DC H6 H 1 6.945 0.01 . 1 . . . . A 4 DC H6 . 34685 2 30 . 1 . 1 4 4 DC P P 31 -3.998 0.05 . 1 . . . . A 4 DC P . 34685 2 31 . 1 . 1 5 5 DC H1' H 1 6.016 0.01 . 1 . . . . A 5 DC H1' . 34685 2 32 . 1 . 1 5 5 DC H3' H 1 5.315 0.01 . 1 . . . . A 5 DC H3' . 34685 2 33 . 1 . 1 5 5 DC H5 H 1 4.654 0.01 . 1 . . . . A 5 DC H5 . 34685 2 34 . 1 . 1 5 5 DC H6 H 1 7.280 0.01 . 1 . . . . A 5 DC H6 . 34685 2 35 . 1 . 1 6 6 DG H2' H 1 4.321 0.01 . 1 . . . . A 6 DG H2' . 34685 2 36 . 1 . 1 6 6 DG H2'' H 1 5.256 0.01 . 1 . . . . A 6 DG H2'' . 34685 2 37 . 1 . 1 6 6 DG H8 H 1 9.250 0.01 . 1 . . . . A 6 DG H8 . 34685 2 38 . 1 . 1 6 6 DG P P 31 -4.241 0.05 . 1 . . . . A 6 DG P . 34685 2 39 . 1 . 1 7 7 DT H2' H 1 3.301 0.01 . 1 . . . . A 7 DT H2' . 34685 2 40 . 1 . 1 7 7 DT H2'' H 1 3.138 0.01 . 1 . . . . A 7 DT H2'' . 34685 2 41 . 1 . 1 7 7 DT H6 H 1 9.427 0.01 . 1 . . . . A 7 DT H6 . 34685 2 42 . 1 . 1 7 7 DT H71 H 1 2.481 0.01 . 3 . . . . A 7 DT H71 . 34685 2 43 . 1 . 1 7 7 DT H72 H 1 2.481 0.01 . 3 . . . . A 7 DT H72 . 34685 2 44 . 1 . 1 7 7 DT H73 H 1 2.481 0.01 . 3 . . . . A 7 DT H73 . 34685 2 45 . 1 . 1 8 8 DC H1' H 1 5.973 0.01 . 1 . . . . A 8 DC H1' . 34685 2 46 . 1 . 1 8 8 DC H2' H 1 1.981 0.01 . 1 . . . . A 8 DC H2' . 34685 2 47 . 1 . 1 8 8 DC H2'' H 1 2.314 0.01 . 1 . . . . A 8 DC H2'' . 34685 2 48 . 1 . 1 8 8 DC H5 H 1 5.874 0.01 . 1 . . . . A 8 DC H5 . 34685 2 49 . 1 . 1 8 8 DC H6 H 1 7.549 0.01 . 1 . . . . A 8 DC H6 . 34685 2 50 . 1 . 1 9 9 DG H1' H 1 5.412 0.01 . 1 . . . . A 9 DG H1' . 34685 2 51 . 1 . 1 9 9 DG H2' H 1 2.745 0.01 . 1 . . . . A 9 DG H2' . 34685 2 52 . 1 . 1 9 9 DG H2'' H 1 2.606 0.01 . 1 . . . . A 9 DG H2'' . 34685 2 53 . 1 . 1 9 9 DG H3' H 1 4.916 0.01 . 1 . . . . A 9 DG H3' . 34685 2 54 . 1 . 1 9 9 DG H4' H 1 4.505 0.01 . 1 . . . . A 9 DG H4' . 34685 2 55 . 1 . 1 9 9 DG H8 H 1 8.221 0.01 . 1 . . . . A 9 DG H8 . 34685 2 56 . 1 . 1 10 10 DA H1' H 1 6.059 0.01 . 1 . . . . A 10 DA H1' . 34685 2 57 . 1 . 1 10 10 DA H2' H 1 2.312 0.01 . 1 . . . . A 10 DA H2' . 34685 2 58 . 1 . 1 10 10 DA H2'' H 1 2.361 0.01 . 1 . . . . A 10 DA H2'' . 34685 2 59 . 1 . 1 10 10 DA H3' H 1 4.613 0.01 . 1 . . . . A 10 DA H3' . 34685 2 60 . 1 . 1 10 10 DA H4' H 1 2.125 0.01 . 1 . . . . A 10 DA H4' . 34685 2 61 . 1 . 1 10 10 DA H5' H 1 3.385 0.01 . 2 . . . . A 10 DA H5' . 34685 2 62 . 1 . 1 10 10 DA H5'' H 1 3.101 0.01 . 2 . . . . A 10 DA H5'' . 34685 2 63 . 1 . 1 10 10 DA H8 H 1 8.195 0.01 . 1 . . . . A 10 DA H8 . 34685 2 64 . 1 . 1 11 11 DA H1' H 1 6.255 0.01 . 1 . . . . A 11 DA H1' . 34685 2 65 . 1 . 1 11 11 DA H2 H 1 8.117 0.01 . 1 . . . . A 11 DA H2 . 34685 2 66 . 1 . 1 11 11 DA H2' H 1 2.983 0.01 . 1 . . . . A 11 DA H2' . 34685 2 67 . 1 . 1 11 11 DA H2'' H 1 2.885 0.01 . 1 . . . . A 11 DA H2'' . 34685 2 68 . 1 . 1 11 11 DA H3' H 1 4.892 0.01 . 1 . . . . A 11 DA H3' . 34685 2 69 . 1 . 1 11 11 DA H8 H 1 8.016 0.01 . 1 . . . . A 11 DA H8 . 34685 2 70 . 1 . 1 12 12 DG H1' H 1 5.076 0.01 . 1 . . . . A 12 DG H1' . 34685 2 71 . 1 . 1 12 12 DG H2' H 1 2.759 0.01 . 1 . . . . A 12 DG H2' . 34685 2 72 . 1 . 1 12 12 DG H2'' H 1 2.649 0.01 . 1 . . . . A 12 DG H2'' . 34685 2 73 . 1 . 1 12 12 DG H3' H 1 4.956 0.01 . 1 . . . . A 12 DG H3' . 34685 2 74 . 1 . 1 12 12 DG H4' H 1 4.383 0.01 . 1 . . . . A 12 DG H4' . 34685 2 75 . 1 . 1 12 12 DG H5' H 1 4.282 0.01 . 2 . . . . A 12 DG H5' . 34685 2 76 . 1 . 1 12 12 DG H5'' H 1 4.152 0.01 . 2 . . . . A 12 DG H5'' . 34685 2 77 . 1 . 1 12 12 DG H8 H 1 8.173 0.01 . 1 . . . . A 12 DG H8 . 34685 2 78 . 1 . 1 12 12 DG P P 31 -4.919 0.05 . 1 . . . . A 12 DG P . 34685 2 79 . 1 . 1 13 13 DA H1' H 1 6.231 0.01 . 1 . . . . A 13 DA H1' . 34685 2 80 . 1 . 1 13 13 DA H2 H 1 7.679 0.01 . 1 . . . . A 13 DA H2 . 34685 2 81 . 1 . 1 13 13 DA H2' H 1 2.625 0.01 . 1 . . . . A 13 DA H2' . 34685 2 82 . 1 . 1 13 13 DA H2'' H 1 2.911 0.01 . 1 . . . . A 13 DA H2'' . 34685 2 83 . 1 . 1 13 13 DA H3' H 1 5.016 0.01 . 1 . . . . A 13 DA H3' . 34685 2 84 . 1 . 1 13 13 DA H4' H 1 4.447 0.01 . 1 . . . . A 13 DA H4' . 34685 2 85 . 1 . 1 13 13 DA H5' H 1 4.188 0.01 . 2 . . . . A 13 DA H5' . 34685 2 86 . 1 . 1 13 13 DA H5'' H 1 4.099 0.01 . 2 . . . . A 13 DA H5'' . 34685 2 87 . 1 . 1 13 13 DA H8 H 1 8.277 0.01 . 1 . . . . A 13 DA H8 . 34685 2 88 . 1 . 1 13 13 DA P P 31 -3.163 0.05 . 1 . . . . A 13 DA P . 34685 2 89 . 1 . 1 14 14 DC H1' H 1 4.928 0.01 . 1 . . . . A 14 DC H1' . 34685 2 90 . 1 . 1 14 14 DC H2' H 1 1.561 0.01 . 1 . . . . A 14 DC H2' . 34685 2 91 . 1 . 1 14 14 DC H2'' H 1 2.053 0.01 . 1 . . . . A 14 DC H2'' . 34685 2 92 . 1 . 1 14 14 DC H5 H 1 5.077 0.01 . 1 . . . . A 14 DC H5 . 34685 2 93 . 1 . 1 14 14 DC H6 H 1 6.941 0.01 . 1 . . . . A 14 DC H6 . 34685 2 94 . 1 . 1 14 14 DC P P 31 -4.495 0.05 . 1 . . . . A 14 DC P . 34685 2 95 . 1 . 1 16 16 DC H1' H 1 5.585 0.01 . 1 . . . . A 16 DC H1' . 34685 2 96 . 1 . 1 16 16 DC H5 H 1 6.031 0.01 . 1 . . . . A 16 DC H5 . 34685 2 97 . 1 . 1 16 16 DC H6 H 1 7.591 0.01 . 1 . . . . A 16 DC H6 . 34685 2 98 . 1 . 1 19 19 DG H1' H 1 6.249 0.01 . 1 . . . . A 19 DG H1' . 34685 2 99 . 1 . 1 19 19 DG H2' H 1 3.373 0.01 . 2 . . . . A 19 DG H2' . 34685 2 100 . 1 . 1 19 19 DG H2'' H 1 3.272 0.01 . 2 . . . . A 19 DG H2'' . 34685 2 101 . 1 . 1 19 19 DG H3' H 1 5.202 0.01 . 1 . . . . A 19 DG H3' . 34685 2 102 . 1 . 1 19 19 DG H8 H 1 8.006 0.01 . 1 . . . . A 19 DG H8 . 34685 2 103 . 1 . 1 20 20 DA H1' H 1 6.460 0.01 . 1 . . . . A 20 DA H1' . 34685 2 104 . 1 . 1 20 20 DA H2' H 1 2.668 0.01 . 1 . . . . A 20 DA H2' . 34685 2 105 . 1 . 1 20 20 DA H3' H 1 4.843 0.01 . 1 . . . . A 20 DA H3' . 34685 2 106 . 1 . 1 20 20 DA H4' H 1 2.504 0.01 . 1 . . . . A 20 DA H4' . 34685 2 107 . 1 . 1 20 20 DA H5' H 1 3.628 0.01 . 2 . . . . A 20 DA H5' . 34685 2 108 . 1 . 1 20 20 DA H5'' H 1 3.365 0.01 . 2 . . . . A 20 DA H5'' . 34685 2 109 . 1 . 1 20 20 DA H8 H 1 8.699 0.01 . 1 . . . . A 20 DA H8 . 34685 2 110 . 1 . 1 21 21 DA H1' H 1 6.503 0.01 . 1 . . . . A 21 DA H1' . 34685 2 111 . 1 . 1 21 21 DA H2 H 1 8.265 0.01 . 1 . . . . A 21 DA H2 . 34685 2 112 . 1 . 1 21 21 DA H2' H 1 2.931 0.01 . 1 . . . . A 21 DA H2' . 34685 2 113 . 1 . 1 21 21 DA H2'' H 1 3.136 0.01 . 1 . . . . A 21 DA H2'' . 34685 2 114 . 1 . 1 21 21 DA H8 H 1 8.324 0.01 . 1 . . . . A 21 DA H8 . 34685 2 115 . 1 . 1 22 22 DG H1' H 1 5.865 0.01 . 1 . . . . A 22 DG H1' . 34685 2 116 . 1 . 1 22 22 DG H2' H 1 2.581 0.01 . 1 . . . . A 22 DG H2' . 34685 2 117 . 1 . 1 22 22 DG H2'' H 1 2.882 0.01 . 1 . . . . A 22 DG H2'' . 34685 2 118 . 1 . 1 22 22 DG H3' H 1 4.968 0.01 . 1 . . . . A 22 DG H3' . 34685 2 119 . 1 . 1 22 22 DG H4' H 1 4.518 0.01 . 1 . . . . A 22 DG H4' . 34685 2 120 . 1 . 1 22 22 DG H8 H 1 8.152 0.01 . 1 . . . . A 22 DG H8 . 34685 2 121 . 1 . 1 23 23 DT H1' H 1 5.898 0.01 . 1 . . . . A 23 DT H1' . 34685 2 122 . 1 . 1 23 23 DT H2' H 1 2.241 0.01 . 1 . . . . A 23 DT H2' . 34685 2 123 . 1 . 1 23 23 DT H2'' H 1 2.452 0.01 . 1 . . . . A 23 DT H2'' . 34685 2 124 . 1 . 1 23 23 DT H6 H 1 7.270 0.01 . 1 . . . . A 23 DT H6 . 34685 2 125 . 1 . 1 23 23 DT H71 H 1 1.668 0.01 . 3 . . . . A 23 DT H71 . 34685 2 126 . 1 . 1 23 23 DT H72 H 1 1.668 0.01 . 3 . . . . A 23 DT H72 . 34685 2 127 . 1 . 1 23 23 DT H73 H 1 1.668 0.01 . 3 . . . . A 23 DT H73 . 34685 2 128 . 1 . 1 24 24 DG H1' H 1 5.610 0.01 . 1 . . . . A 24 DG H1' . 34685 2 129 . 1 . 1 24 24 DG H2' H 1 2.282 0.01 . 1 . . . . A 24 DG H2' . 34685 2 130 . 1 . 1 24 24 DG H2'' H 1 2.538 0.01 . 1 . . . . A 24 DG H2'' . 34685 2 131 . 1 . 1 24 24 DG H3' H 1 4.881 0.01 . 1 . . . . A 24 DG H3' . 34685 2 132 . 1 . 1 24 24 DG H4' H 1 4.236 0.01 . 1 . . . . A 24 DG H4' . 34685 2 133 . 1 . 1 24 24 DG H8 H 1 7.562 0.01 . 1 . . . . A 24 DG H8 . 34685 2 134 . 1 . 1 25 25 DG H1' H 1 5.839 0.01 . 1 . . . . A 25 DG H1' . 34685 2 135 . 1 . 1 25 25 DG H2' H 1 2.539 0.01 . 1 . . . . A 25 DG H2' . 34685 2 136 . 1 . 1 25 25 DG H2'' H 1 2.682 0.01 . 1 . . . . A 25 DG H2'' . 34685 2 137 . 1 . 1 25 25 DG H3' H 1 4.922 0.01 . 1 . . . . A 25 DG H3' . 34685 2 138 . 1 . 1 25 25 DG H4' H 1 4.296 0.01 . 1 . . . . A 25 DG H4' . 34685 2 139 . 1 . 1 25 25 DG H8 H 1 7.736 0.01 . 1 . . . . A 25 DG H8 . 34685 2 140 . 1 . 1 25 25 DG P P 31 -4.162 0.05 . 1 . . . . A 25 DG P . 34685 2 141 . 1 . 1 26 26 DC H1' H 1 5.930 0.01 . 1 . . . . A 26 DC H1' . 34685 2 142 . 1 . 1 26 26 DC H2' H 1 2.005 0.01 . 1 . . . . A 26 DC H2' . 34685 2 143 . 1 . 1 26 26 DC H2'' H 1 2.424 0.01 . 1 . . . . A 26 DC H2'' . 34685 2 144 . 1 . 1 26 26 DC H3' H 1 4.793 0.01 . 1 . . . . A 26 DC H3' . 34685 2 145 . 1 . 1 26 26 DC H4' H 1 4.149 0.01 . 1 . . . . A 26 DC H4' . 34685 2 146 . 1 . 1 26 26 DC H5 H 1 5.258 0.01 . 1 . . . . A 26 DC H5 . 34685 2 147 . 1 . 1 26 26 DC H6 H 1 7.298 0.01 . 1 . . . . A 26 DC H6 . 34685 2 148 . 1 . 1 26 26 DC P P 31 -4.160 0.05 . 1 . . . . A 26 DC P . 34685 2 149 . 1 . 1 27 27 DC H1' H 1 5.639 0.01 . 1 . . . . A 27 DC H1' . 34685 2 150 . 1 . 1 27 27 DC H2' H 1 1.994 0.01 . 1 . . . . A 27 DC H2' . 34685 2 151 . 1 . 1 27 27 DC H2'' H 1 2.345 0.01 . 1 . . . . A 27 DC H2'' . 34685 2 152 . 1 . 1 27 27 DC H3' H 1 4.836 0.01 . 1 . . . . A 27 DC H3' . 34685 2 153 . 1 . 1 27 27 DC H4' H 1 4.117 0.01 . 1 . . . . A 27 DC H4' . 34685 2 154 . 1 . 1 27 27 DC H5 H 1 5.636 0.01 . 1 . . . . A 27 DC H5 . 34685 2 155 . 1 . 1 27 27 DC H6 H 1 7.453 0.01 . 1 . . . . A 27 DC H6 . 34685 2 156 . 1 . 1 27 27 DC P P 31 -4.043 0.05 . 1 . . . . A 27 DC P . 34685 2 157 . 1 . 1 28 28 DG H1' H 1 6.205 0.01 . 1 . . . . A 28 DG H1' . 34685 2 158 . 1 . 1 28 28 DG H2' H 1 2.657 0.01 . 1 . . . . A 28 DG H2' . 34685 2 159 . 1 . 1 28 28 DG H2'' H 1 2.399 0.01 . 1 . . . . A 28 DG H2'' . 34685 2 160 . 1 . 1 28 28 DG H3' H 1 4.712 0.01 . 1 . . . . A 28 DG H3' . 34685 2 161 . 1 . 1 28 28 DG H4' H 1 4.216 0.01 . 1 . . . . A 28 DG H4' . 34685 2 162 . 1 . 1 28 28 DG H5'' H 1 4.107 0.01 . 2 . . . . A 28 DG H5'' . 34685 2 163 . 1 . 1 28 28 DG H8 H 1 7.975 0.01 . 1 . . . . A 28 DG H8 . 34685 2 164 . 1 . 1 28 28 DG P P 31 -3.666 0.05 . 1 . . . . A 28 DG P . 34685 2 stop_ save_ save_assigned_chemical_shifts_3 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_3 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 3 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 9 '2D NOESY' . . . 34685 3 10 '2D 1H-13C HSQC' . . . 34685 3 11 '2D 1H-1H TOCSY' . . . 34685 3 12 '2D 1H-31P COSY' . . . 34685 3 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DC H1' H 1 5.764 0.01 . 1 . . . . A 1 DC H1' . 34685 3 2 . 1 . 1 1 1 DC H2' H 1 1.880 0.01 . 1 . . . . A 1 DC H2' . 34685 3 3 . 1 . 1 1 1 DC H2'' H 1 2.383 0.01 . 1 . . . . A 1 DC H2'' . 34685 3 4 . 1 . 1 1 1 DC H3' H 1 4.711 0.01 . 1 . . . . A 1 DC H3' . 34685 3 5 . 1 . 1 1 1 DC H4' H 1 4.077 0.01 . 1 . . . . A 1 DC H4' . 34685 3 6 . 1 . 1 1 1 DC H5 H 1 5.906 0.01 . 1 . . . . A 1 DC H5 . 34685 3 7 . 1 . 1 1 1 DC H6 H 1 7.607 0.01 . 1 . . . . A 1 DC H6 . 34685 3 8 . 1 . 1 2 2 DG H1' H 1 5.557 0.01 . 1 . . . . A 2 DG H1' . 34685 3 9 . 1 . 1 2 2 DG H2' H 1 2.751 0.01 . 1 . . . . A 2 DG H2' . 34685 3 10 . 1 . 1 2 2 DG H2'' H 1 2.800 0.01 . 1 . . . . A 2 DG H2'' . 34685 3 11 . 1 . 1 2 2 DG H3' H 1 5.034 0.01 . 1 . . . . A 2 DG H3' . 34685 3 12 . 1 . 1 2 2 DG H4' H 1 4.346 0.01 . 1 . . . . A 2 DG H4' . 34685 3 13 . 1 . 1 2 2 DG H5'' H 1 3.997 0.01 . 2 . . . . A 2 DG H5'' . 34685 3 14 . 1 . 1 2 2 DG H8 H 1 7.953 0.01 . 1 . . . . A 2 DG H8 . 34685 3 15 . 1 . 1 2 2 DG P P 31 -3.886 0.05 . 1 . . . . A 2 DG P . 34685 3 16 . 1 . 1 3 3 DG H1' H 1 6.029 0.01 . 1 . . . . A 3 DG H1' . 34685 3 17 . 1 . 1 3 3 DG H2' H 1 2.680 0.01 . 1 . . . . A 3 DG H2' . 34685 3 18 . 1 . 1 3 3 DG H2'' H 1 2.780 0.01 . 1 . . . . A 3 DG H2'' . 34685 3 19 . 1 . 1 3 3 DG H3' H 1 5.132 0.01 . 1 . . . . A 3 DG H3' . 34685 3 20 . 1 . 1 3 3 DG H4' H 1 4.512 0.01 . 1 . . . . A 3 DG H4' . 34685 3 21 . 1 . 1 3 3 DG H8 H 1 7.891 0.01 . 1 . . . . A 3 DG H8 . 34685 3 22 . 1 . 1 3 3 DG P P 31 -3.761 0.05 . 1 . . . . A 3 DG P . 34685 3 23 . 1 . 1 4 4 DC H1' H 1 5.951 0.01 . 1 . . . . A 4 DC H1' . 34685 3 24 . 1 . 1 4 4 DC H2' H 1 1.404 0.01 . 1 . . . . A 4 DC H2' . 34685 3 25 . 1 . 1 4 4 DC H2'' H 1 2.339 0.01 . 1 . . . . A 4 DC H2'' . 34685 3 26 . 1 . 1 4 4 DC H3' H 1 4.914 0.01 . 1 . . . . A 4 DC H3' . 34685 3 27 . 1 . 1 4 4 DC H4' H 1 4.239 0.01 . 1 . . . . A 4 DC H4' . 34685 3 28 . 1 . 1 4 4 DC H5 H 1 5.417 0.01 . 1 . . . . A 4 DC H5 . 34685 3 29 . 1 . 1 4 4 DC H6 H 1 7.038 0.01 . 1 . . . . A 4 DC H6 . 34685 3 30 . 1 . 1 4 4 DC P P 31 -3.878 0.05 . 1 . . . . A 4 DC P . 34685 3 31 . 1 . 1 5 5 DC H1' H 1 5.390 0.01 . 1 . . . . A 5 DC H1' . 34685 3 32 . 1 . 1 5 5 DC H2' H 1 1.610 0.01 . 1 . . . . A 5 DC H2' . 34685 3 33 . 1 . 1 5 5 DC H2'' H 1 0.632 0.01 . 1 . . . . A 5 DC H2'' . 34685 3 34 . 1 . 1 5 5 DC H3' H 1 4.751 0.01 . 1 . . . . A 5 DC H3' . 34685 3 35 . 1 . 1 5 5 DC H4' H 1 3.843 0.01 . 1 . . . . A 5 DC H4' . 34685 3 36 . 1 . 1 5 5 DC H5 H 1 5.019 0.01 . 1 . . . . A 5 DC H5 . 34685 3 37 . 1 . 1 5 5 DC H6 H 1 7.100 0.01 . 1 . . . . A 5 DC H6 . 34685 3 38 . 1 . 1 5 5 DC P P 31 -4.232 0.05 . 1 . . . . A 5 DC P . 34685 3 39 . 1 . 1 6 6 DG P P 31 -5.058 0.05 . 1 . . . . A 6 DG P . 34685 3 40 . 1 . 1 8 8 DC H1' H 1 6.519 0.01 . 1 . . . . A 8 DC H1' . 34685 3 41 . 1 . 1 8 8 DC H2' H 1 2.665 0.01 . 1 . . . . A 8 DC H2' . 34685 3 42 . 1 . 1 8 8 DC H2'' H 1 2.768 0.01 . 1 . . . . A 8 DC H2'' . 34685 3 43 . 1 . 1 8 8 DC H3' H 1 5.425 0.01 . 1 . . . . A 8 DC H3' . 34685 3 44 . 1 . 1 8 8 DC H5 H 1 6.382 0.01 . 1 . . . . A 8 DC H5 . 34685 3 45 . 1 . 1 8 8 DC H6 H 1 8.330 0.01 . 1 . . . . A 8 DC H6 . 34685 3 46 . 1 . 1 9 9 DG H1' H 1 5.604 0.01 . 1 . . . . A 9 DG H1' . 34685 3 47 . 1 . 1 9 9 DG H2' H 1 2.962 0.01 . 1 . . . . A 9 DG H2' . 34685 3 48 . 1 . 1 9 9 DG H2'' H 1 2.769 0.01 . 1 . . . . A 9 DG H2'' . 34685 3 49 . 1 . 1 9 9 DG H3' H 1 5.069 0.01 . 1 . . . . A 9 DG H3' . 34685 3 50 . 1 . 1 9 9 DG H4' H 1 4.694 0.01 . 1 . . . . A 9 DG H4' . 34685 3 51 . 1 . 1 9 9 DG H5'' H 1 4.356 0.01 . 2 . . . . A 9 DG H5'' . 34685 3 52 . 1 . 1 9 9 DG H8 H 1 8.515 0.01 . 1 . . . . A 9 DG H8 . 34685 3 53 . 1 . 1 9 9 DG P P 31 -4.487 0.05 . 1 . . . . A 9 DG P . 34685 3 54 . 1 . 1 10 10 DA H1' H 1 6.140 0.01 . 1 . . . . A 10 DA H1' . 34685 3 55 . 1 . 1 10 10 DA H2' H 1 2.388 0.01 . 1 . . . . A 10 DA H2' . 34685 3 56 . 1 . 1 10 10 DA H2'' H 1 2.431 0.01 . 1 . . . . A 10 DA H2'' . 34685 3 57 . 1 . 1 10 10 DA H3' H 1 4.678 0.01 . 1 . . . . A 10 DA H3' . 34685 3 58 . 1 . 1 10 10 DA H4' H 1 2.207 0.01 . 1 . . . . A 10 DA H4' . 34685 3 59 . 1 . 1 10 10 DA H5' H 1 3.477 0.01 . 2 . . . . A 10 DA H5' . 34685 3 60 . 1 . 1 10 10 DA H5'' H 1 3.240 0.01 . 2 . . . . A 10 DA H5'' . 34685 3 61 . 1 . 1 10 10 DA H8 H 1 8.314 0.01 . 1 . . . . A 10 DA H8 . 34685 3 62 . 1 . 1 11 11 DA H1' H 1 6.307 0.01 . 1 . . . . A 11 DA H1' . 34685 3 63 . 1 . 1 11 11 DA H2' H 1 3.045 0.01 . 1 . . . . A 11 DA H2' . 34685 3 64 . 1 . 1 11 11 DA H2'' H 1 2.934 0.01 . 1 . . . . A 11 DA H2'' . 34685 3 65 . 1 . 1 11 11 DA H3' H 1 4.928 0.01 . 1 . . . . A 11 DA H3' . 34685 3 66 . 1 . 1 11 11 DA H8 H 1 8.089 0.01 . 1 . . . . A 11 DA H8 . 34685 3 67 . 1 . 1 11 11 DA P P 31 -4.428 0.05 . 1 . . . . A 11 DA P . 34685 3 68 . 1 . 1 12 12 DG H1' H 1 5.135 0.01 . 1 . . . . A 12 DG H1' . 34685 3 69 . 1 . 1 12 12 DG H2' H 1 2.782 0.01 . 1 . . . . A 12 DG H2' . 34685 3 70 . 1 . 1 12 12 DG H2'' H 1 2.681 0.01 . 1 . . . . A 12 DG H2'' . 34685 3 71 . 1 . 1 12 12 DG H3' H 1 4.972 0.01 . 1 . . . . A 12 DG H3' . 34685 3 72 . 1 . 1 12 12 DG H4' H 1 4.400 0.01 . 1 . . . . A 12 DG H4' . 34685 3 73 . 1 . 1 12 12 DG H5' H 1 4.313 0.01 . 2 . . . . A 12 DG H5' . 34685 3 74 . 1 . 1 12 12 DG H5'' H 1 4.168 0.01 . 2 . . . . A 12 DG H5'' . 34685 3 75 . 1 . 1 12 12 DG H8 H 1 8.226 0.01 . 1 . . . . A 12 DG H8 . 34685 3 76 . 1 . 1 12 12 DG P P 31 -4.867 0.05 . 1 . . . . A 12 DG P . 34685 3 77 . 1 . 1 13 13 DA H1' H 1 6.034 0.01 . 1 . . . . A 13 DA H1' . 34685 3 78 . 1 . 1 13 13 DA H2' H 1 2.538 0.01 . 1 . . . . A 13 DA H2' . 34685 3 79 . 1 . 1 13 13 DA H2'' H 1 2.720 0.01 . 1 . . . . A 13 DA H2'' . 34685 3 80 . 1 . 1 13 13 DA H3' H 1 4.915 0.01 . 1 . . . . A 13 DA H3' . 34685 3 81 . 1 . 1 13 13 DA H4' H 1 4.355 0.01 . 1 . . . . A 13 DA H4' . 34685 3 82 . 1 . 1 13 13 DA H5'' H 1 4.071 0.01 . 2 . . . . A 13 DA H5'' . 34685 3 83 . 1 . 1 13 13 DA H8 H 1 8.267 0.01 . 1 . . . . A 13 DA H8 . 34685 3 84 . 1 . 1 13 13 DA P P 31 -3.185 0.05 . 1 . . . . A 13 DA P . 34685 3 85 . 1 . 1 14 14 DC H5 H 1 5.089 0.01 . 1 . . . . A 14 DC H5 . 34685 3 86 . 1 . 1 14 14 DC H6 H 1 6.733 0.01 . 1 . . . . A 14 DC H6 . 34685 3 87 . 1 . 1 16 16 DC H1' H 1 5.915 0.01 . 1 . . . . A 16 DC H1' . 34685 3 88 . 1 . 1 16 16 DC H5 H 1 6.190 0.01 . 1 . . . . A 16 DC H5 . 34685 3 89 . 1 . 1 16 16 DC H6 H 1 7.820 0.01 . 1 . . . . A 16 DC H6 . 34685 3 90 . 1 . 1 19 19 DG H1' H 1 6.725 0.01 . 1 . . . . A 19 DG H1' . 34685 3 91 . 1 . 1 19 19 DG H3' H 1 5.346 0.01 . 1 . . . . A 19 DG H3' . 34685 3 92 . 1 . 1 20 20 DA H1' H 1 6.559 0.01 . 1 . . . . A 20 DA H1' . 34685 3 93 . 1 . 1 20 20 DA H3' H 1 4.872 0.01 . 1 . . . . A 20 DA H3' . 34685 3 94 . 1 . 1 20 20 DA H5' H 1 3.736 0.01 . 2 . . . . A 20 DA H5' . 34685 3 95 . 1 . 1 20 20 DA H5'' H 1 3.549 0.01 . 2 . . . . A 20 DA H5'' . 34685 3 96 . 1 . 1 20 20 DA H8 H 1 8.570 0.01 . 1 . . . . A 20 DA H8 . 34685 3 97 . 1 . 1 21 21 DA H1' H 1 6.714 0.01 . 1 . . . . A 21 DA H1' . 34685 3 98 . 1 . 1 21 21 DA H2' H 1 3.065 0.01 . 1 . . . . A 21 DA H2' . 34685 3 99 . 1 . 1 21 21 DA H2'' H 1 3.304 0.01 . 1 . . . . A 21 DA H2'' . 34685 3 100 . 1 . 1 21 21 DA H3' H 1 5.091 0.01 . 1 . . . . A 21 DA H3' . 34685 3 101 . 1 . 1 21 21 DA H8 H 1 8.584 0.01 . 1 . . . . A 21 DA H8 . 34685 3 102 . 1 . 1 22 22 DG H1' H 1 6.058 0.01 . 1 . . . . A 22 DG H1' . 34685 3 103 . 1 . 1 22 22 DG H2' H 1 2.775 0.01 . 1 . . . . A 22 DG H2' . 34685 3 104 . 1 . 1 22 22 DG H2'' H 1 3.062 0.01 . 1 . . . . A 22 DG H2'' . 34685 3 105 . 1 . 1 22 22 DG H3' H 1 5.106 0.01 . 1 . . . . A 22 DG H3' . 34685 3 106 . 1 . 1 22 22 DG H4' H 1 4.638 0.01 . 1 . . . . A 22 DG H4' . 34685 3 107 . 1 . 1 22 22 DG H5' H 1 4.559 0.01 . 2 . . . . A 22 DG H5' . 34685 3 108 . 1 . 1 22 22 DG H5'' H 1 4.363 0.01 . 2 . . . . A 22 DG H5'' . 34685 3 109 . 1 . 1 22 22 DG H8 H 1 8.410 0.01 . 1 . . . . A 22 DG H8 . 34685 3 110 . 1 . 1 22 22 DG P P 31 -4.665 0.05 . 1 . . . . A 22 DG P . 34685 3 111 . 1 . 1 23 23 DT H1' H 1 6.104 0.01 . 1 . . . . A 23 DT H1' . 34685 3 112 . 1 . 1 23 23 DT H2' H 1 2.399 0.01 . 1 . . . . A 23 DT H2' . 34685 3 113 . 1 . 1 23 23 DT H2'' H 1 2.651 0.01 . 1 . . . . A 23 DT H2'' . 34685 3 114 . 1 . 1 23 23 DT H3' H 1 4.849 0.01 . 1 . . . . A 23 DT H3' . 34685 3 115 . 1 . 1 23 23 DT H4' H 1 4.471 0.01 . 1 . . . . A 23 DT H4' . 34685 3 116 . 1 . 1 23 23 DT H5'' H 1 4.204 0.01 . 2 . . . . A 23 DT H5'' . 34685 3 117 . 1 . 1 23 23 DT H6 H 1 7.462 0.01 . 1 . . . . A 23 DT H6 . 34685 3 118 . 1 . 1 23 23 DT H71 H 1 1.921 0.01 . 3 . . . . A 23 DT H71 . 34685 3 119 . 1 . 1 23 23 DT H72 H 1 1.921 0.01 . 3 . . . . A 23 DT H72 . 34685 3 120 . 1 . 1 23 23 DT H73 H 1 1.921 0.01 . 3 . . . . A 23 DT H73 . 34685 3 121 . 1 . 1 23 23 DT P P 31 -4.341 0.05 . 1 . . . . A 23 DT P . 34685 3 122 . 1 . 1 24 24 DG H1' H 1 5.601 0.01 . 1 . . . . A 24 DG H1' . 34685 3 123 . 1 . 1 24 24 DG H2' H 1 2.290 0.01 . 1 . . . . A 24 DG H2' . 34685 3 124 . 1 . 1 24 24 DG H2'' H 1 2.502 0.01 . 1 . . . . A 24 DG H2'' . 34685 3 125 . 1 . 1 24 24 DG H3' H 1 4.859 0.01 . 1 . . . . A 24 DG H3' . 34685 3 126 . 1 . 1 24 24 DG H8 H 1 7.657 0.01 . 1 . . . . A 24 DG H8 . 34685 3 127 . 1 . 1 25 25 DG H1' H 1 5.676 0.01 . 1 . . . . A 25 DG H1' . 34685 3 128 . 1 . 1 25 25 DG H2' H 1 2.444 0.01 . 1 . . . . A 25 DG H2' . 34685 3 129 . 1 . 1 25 25 DG H2'' H 1 2.577 0.01 . 1 . . . . A 25 DG H2'' . 34685 3 130 . 1 . 1 25 25 DG H3' H 1 4.817 0.01 . 1 . . . . A 25 DG H3' . 34685 3 131 . 1 . 1 25 25 DG H4' H 1 4.114 0.01 . 1 . . . . A 25 DG H4' . 34685 3 132 . 1 . 1 25 25 DG H8 H 1 7.668 0.01 . 1 . . . . A 25 DG H8 . 34685 3 133 . 1 . 1 25 25 DG P P 31 -4.266 0.05 . 1 . . . . A 25 DG P . 34685 3 134 . 1 . 1 26 26 DC H1' H 1 5.821 0.01 . 1 . . . . A 26 DC H1' . 34685 3 135 . 1 . 1 26 26 DC H2' H 1 1.930 0.01 . 1 . . . . A 26 DC H2' . 34685 3 136 . 1 . 1 26 26 DC H2'' H 1 2.339 0.01 . 1 . . . . A 26 DC H2'' . 34685 3 137 . 1 . 1 26 26 DC H3' H 1 4.697 0.01 . 1 . . . . A 26 DC H3' . 34685 3 138 . 1 . 1 26 26 DC H5 H 1 5.192 0.01 . 1 . . . . A 26 DC H5 . 34685 3 139 . 1 . 1 26 26 DC H6 H 1 7.220 0.01 . 1 . . . . A 26 DC H6 . 34685 3 140 . 1 . 1 27 27 DC H1' H 1 5.597 0.01 . 1 . . . . A 27 DC H1' . 34685 3 141 . 1 . 1 27 27 DC H2' H 1 1.940 0.01 . 1 . . . . A 27 DC H2' . 34685 3 142 . 1 . 1 27 27 DC H2'' H 1 2.308 0.01 . 1 . . . . A 27 DC H2'' . 34685 3 143 . 1 . 1 27 27 DC H3' H 1 4.782 0.01 . 1 . . . . A 27 DC H3' . 34685 3 144 . 1 . 1 27 27 DC H4' H 1 4.048 0.01 . 1 . . . . A 27 DC H4' . 34685 3 145 . 1 . 1 27 27 DC H5 H 1 5.594 0.01 . 1 . . . . A 27 DC H5 . 34685 3 146 . 1 . 1 27 27 DC H6 H 1 7.404 0.01 . 1 . . . . A 27 DC H6 . 34685 3 147 . 1 . 1 27 27 DC P P 31 -4.130 0.05 . 1 . . . . A 27 DC P . 34685 3 148 . 1 . 1 28 28 DG H1' H 1 6.201 0.01 . 1 . . . . A 28 DG H1' . 34685 3 149 . 1 . 1 28 28 DG H2' H 1 2.645 0.01 . 1 . . . . A 28 DG H2' . 34685 3 150 . 1 . 1 28 28 DG H2'' H 1 2.391 0.01 . 1 . . . . A 28 DG H2'' . 34685 3 151 . 1 . 1 28 28 DG H8 H 1 7.953 0.01 . 1 . . . . A 28 DG H8 . 34685 3 stop_ save_ save_assigned_chemical_shifts_4 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_4 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 4 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 13 '2D NOESY' . . . 34685 4 14 '2D 1H-13C HSQC' . . . 34685 4 15 '2D 1H-1H TOCSY' . . . 34685 4 16 '2D 1H-31P COSY' . . . 34685 4 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DC H1' H 1 5.755 0.01 . 1 . . . . A 1 DC H1' . 34685 4 2 . 1 . 1 1 1 DC H2' H 1 1.858 0.01 . 1 . . . . A 1 DC H2' . 34685 4 3 . 1 . 1 1 1 DC H2'' H 1 2.361 0.01 . 1 . . . . A 1 DC H2'' . 34685 4 4 . 1 . 1 1 1 DC H3' H 1 4.685 0.01 . 1 . . . . A 1 DC H3' . 34685 4 5 . 1 . 1 1 1 DC H5 H 1 5.918 0.01 . 1 . . . . A 1 DC H5 . 34685 4 6 . 1 . 1 1 1 DC H6 H 1 7.601 0.01 . 1 . . . . A 1 DC H6 . 34685 4 7 . 1 . 1 2 2 DG H1' H 1 5.513 0.01 . 1 . . . . A 2 DG H1' . 34685 4 8 . 1 . 1 2 2 DG H2' H 1 2.685 0.01 . 1 . . . . A 2 DG H2' . 34685 4 9 . 1 . 1 2 2 DG H2'' H 1 2.732 0.01 . 1 . . . . A 2 DG H2'' . 34685 4 10 . 1 . 1 2 2 DG H3' H 1 4.969 0.01 . 1 . . . . A 2 DG H3' . 34685 4 11 . 1 . 1 2 2 DG H4' H 1 4.304 0.01 . 1 . . . . A 2 DG H4' . 34685 4 12 . 1 . 1 2 2 DG H8 H 1 7.915 0.01 . 1 . . . . A 2 DG H8 . 34685 4 13 . 1 . 1 2 2 DG P P 31 -3.917 0.05 . 1 . . . . A 2 DG P . 34685 4 14 . 1 . 1 3 3 DG H1' H 1 5.957 0.01 . 1 . . . . A 3 DG H1' . 34685 4 15 . 1 . 1 3 3 DG H2' H 1 2.598 0.01 . 1 . . . . A 3 DG H2' . 34685 4 16 . 1 . 1 3 3 DG H2'' H 1 2.653 0.01 . 1 . . . . A 3 DG H2'' . 34685 4 17 . 1 . 1 3 3 DG H3' H 1 5.043 0.01 . 1 . . . . A 3 DG H3' . 34685 4 18 . 1 . 1 3 3 DG H4' H 1 4.455 0.01 . 1 . . . . A 3 DG H4' . 34685 4 19 . 1 . 1 3 3 DG H8 H 1 7.803 0.01 . 1 . . . . A 3 DG H8 . 34685 4 20 . 1 . 1 3 3 DG P P 31 -3.814 0.05 . 1 . . . . A 3 DG P . 34685 4 21 . 1 . 1 4 4 DC H1' H 1 5.994 0.01 . 1 . . . . A 4 DC H1' . 34685 4 22 . 1 . 1 4 4 DC H2' H 1 1.372 0.01 . 1 . . . . A 4 DC H2' . 34685 4 23 . 1 . 1 4 4 DC H2'' H 1 2.269 0.01 . 1 . . . . A 4 DC H2'' . 34685 4 24 . 1 . 1 4 4 DC H3' H 1 4.817 0.01 . 1 . . . . A 4 DC H3' . 34685 4 25 . 1 . 1 4 4 DC H5 H 1 5.240 0.01 . 1 . . . . A 4 DC H5 . 34685 4 26 . 1 . 1 4 4 DC H6 H 1 6.987 0.01 . 1 . . . . A 4 DC H6 . 34685 4 27 . 1 . 1 4 4 DC P P 31 -4.019 0.05 . 1 . . . . A 4 DC P . 34685 4 28 . 1 . 1 5 5 DC H1' H 1 6.027 0.01 . 1 . . . . A 5 DC H1' . 34685 4 29 . 1 . 1 5 5 DC H2' H 1 1.778 0.01 . 1 . . . . A 5 DC H2' . 34685 4 30 . 1 . 1 5 5 DC H2'' H 1 1.292 0.01 . 1 . . . . A 5 DC H2'' . 34685 4 31 . 1 . 1 5 5 DC H3' H 1 4.606 0.01 . 1 . . . . A 5 DC H3' . 34685 4 32 . 1 . 1 5 5 DC H5 H 1 4.774 0.01 . 1 . . . . A 5 DC H5 . 34685 4 33 . 1 . 1 5 5 DC H6 H 1 7.143 0.01 . 1 . . . . A 5 DC H6 . 34685 4 34 . 1 . 1 6 6 DG H8 H 1 7.354 0.01 . 1 . . . . A 6 DG H8 . 34685 4 35 . 1 . 1 6 6 DG P P 31 -4.833 0.05 . 1 . . . . A 6 DG P . 34685 4 36 . 1 . 1 7 7 DT H6 H 1 6.462 0.01 . 1 . . . . A 7 DT H6 . 34685 4 37 . 1 . 1 7 7 DT H71 H 1 0.844 0.01 . 3 . . . . A 7 DT H71 . 34685 4 38 . 1 . 1 7 7 DT H72 H 1 0.844 0.01 . 3 . . . . A 7 DT H72 . 34685 4 39 . 1 . 1 7 7 DT H73 H 1 0.844 0.01 . 3 . . . . A 7 DT H73 . 34685 4 40 . 1 . 1 8 8 DC H1' H 1 6.180 0.01 . 1 . . . . A 8 DC H1' . 34685 4 41 . 1 . 1 8 8 DC H2' H 1 1.865 0.01 . 1 . . . . A 8 DC H2' . 34685 4 42 . 1 . 1 8 8 DC H2'' H 1 2.329 0.01 . 1 . . . . A 8 DC H2'' . 34685 4 43 . 1 . 1 8 8 DC H3' H 1 4.926 0.01 . 1 . . . . A 8 DC H3' . 34685 4 44 . 1 . 1 8 8 DC H5 H 1 5.173 0.01 . 1 . . . . A 8 DC H5 . 34685 4 45 . 1 . 1 8 8 DC H6 H 1 7.155 0.01 . 1 . . . . A 8 DC H6 . 34685 4 46 . 1 . 1 9 9 DG H1' H 1 5.380 0.01 . 1 . . . . A 9 DG H1' . 34685 4 47 . 1 . 1 9 9 DG H2' H 1 2.748 0.01 . 1 . . . . A 9 DG H2' . 34685 4 48 . 1 . 1 9 9 DG H2'' H 1 2.593 0.01 . 1 . . . . A 9 DG H2'' . 34685 4 49 . 1 . 1 9 9 DG H4' H 1 4.617 0.01 . 1 . . . . A 9 DG H4' . 34685 4 50 . 1 . 1 9 9 DG H5'' H 1 4.305 0.01 . 2 . . . . A 9 DG H5'' . 34685 4 51 . 1 . 1 9 9 DG H8 H 1 8.149 0.01 . 1 . . . . A 9 DG H8 . 34685 4 52 . 1 . 1 9 9 DG P P 31 -4.662 0.05 . 1 . . . . A 9 DG P . 34685 4 53 . 1 . 1 10 10 DA H1' H 1 5.992 0.01 . 1 . . . . A 10 DA H1' . 34685 4 54 . 1 . 1 10 10 DA H3' H 1 4.614 0.01 . 1 . . . . A 10 DA H3' . 34685 4 55 . 1 . 1 10 10 DA H4' H 1 2.129 0.01 . 1 . . . . A 10 DA H4' . 34685 4 56 . 1 . 1 10 10 DA H5' H 1 3.431 0.01 . 2 . . . . A 10 DA H5' . 34685 4 57 . 1 . 1 10 10 DA H5'' H 1 3.174 0.01 . 2 . . . . A 10 DA H5'' . 34685 4 58 . 1 . 1 10 10 DA H8 H 1 8.166 0.01 . 1 . . . . A 10 DA H8 . 34685 4 59 . 1 . 1 11 11 DA H1' H 1 6.306 0.01 . 1 . . . . A 11 DA H1' . 34685 4 60 . 1 . 1 11 11 DA H2 H 1 8.100 0.01 . 1 . . . . A 11 DA H2 . 34685 4 61 . 1 . 1 11 11 DA H2' H 1 2.943 0.01 . 1 . . . . A 11 DA H2' . 34685 4 62 . 1 . 1 11 11 DA H2'' H 1 2.891 0.01 . 1 . . . . A 11 DA H2'' . 34685 4 63 . 1 . 1 11 11 DA H3' H 1 4.877 0.01 . 1 . . . . A 11 DA H3' . 34685 4 64 . 1 . 1 11 11 DA H8 H 1 8.023 0.01 . 1 . . . . A 11 DA H8 . 34685 4 65 . 1 . 1 11 11 DA P P 31 -4.497 0.05 . 1 . . . . A 11 DA P . 34685 4 66 . 1 . 1 12 12 DG H1' H 1 5.231 0.01 . 1 . . . . A 12 DG H1' . 34685 4 67 . 1 . 1 12 12 DG H2' H 1 2.795 0.01 . 1 . . . . A 12 DG H2' . 34685 4 68 . 1 . 1 12 12 DG H2'' H 1 2.745 0.01 . 1 . . . . A 12 DG H2'' . 34685 4 69 . 1 . 1 12 12 DG H3' H 1 5.037 0.01 . 1 . . . . A 12 DG H3' . 34685 4 70 . 1 . 1 12 12 DG H4' H 1 4.496 0.01 . 1 . . . . A 12 DG H4' . 34685 4 71 . 1 . 1 12 12 DG H5' H 1 4.346 0.01 . 2 . . . . A 12 DG H5' . 34685 4 72 . 1 . 1 12 12 DG H5'' H 1 4.214 0.01 . 2 . . . . A 12 DG H5'' . 34685 4 73 . 1 . 1 12 12 DG H8 H 1 8.145 0.01 . 1 . . . . A 12 DG H8 . 34685 4 74 . 1 . 1 12 12 DG P P 31 -4.885 0.05 . 1 . . . . A 12 DG P . 34685 4 75 . 1 . 1 13 13 DA H1' H 1 6.846 0.01 . 1 . . . . A 13 DA H1' . 34685 4 76 . 1 . 1 13 13 DA H2 H 1 8.975 0.01 . 1 . . . . A 13 DA H2 . 34685 4 77 . 1 . 1 13 13 DA H2' H 1 2.972 0.01 . 1 . . . . A 13 DA H2' . 34685 4 78 . 1 . 1 13 13 DA H2'' H 1 3.391 0.01 . 1 . . . . A 13 DA H2'' . 34685 4 79 . 1 . 1 13 13 DA H3' H 1 5.299 0.01 . 1 . . . . A 13 DA H3' . 34685 4 80 . 1 . 1 13 13 DA H4' H 1 4.757 0.01 . 1 . . . . A 13 DA H4' . 34685 4 81 . 1 . 1 13 13 DA H5' H 1 4.389 0.01 . 2 . . . . A 13 DA H5' . 34685 4 82 . 1 . 1 13 13 DA H5'' H 1 4.310 0.01 . 2 . . . . A 13 DA H5'' . 34685 4 83 . 1 . 1 13 13 DA H8 H 1 8.531 0.01 . 1 . . . . A 13 DA H8 . 34685 4 84 . 1 . 1 13 13 DA P P 31 -3.041 0.05 . 1 . . . . A 13 DA P . 34685 4 85 . 1 . 1 14 14 DC H1' H 1 7.103 0.01 . 1 . . . . A 14 DC H1' . 34685 4 86 . 1 . 1 14 14 DC H2' H 1 2.396 0.01 . 1 . . . . A 14 DC H2' . 34685 4 87 . 1 . 1 14 14 DC H2'' H 1 3.242 0.01 . 1 . . . . A 14 DC H2'' . 34685 4 88 . 1 . 1 14 14 DC H3' H 1 5.238 0.01 . 1 . . . . A 14 DC H3' . 34685 4 89 . 1 . 1 14 14 DC H4' H 1 4.836 0.01 . 1 . . . . A 14 DC H4' . 34685 4 90 . 1 . 1 14 14 DC H5 H 1 5.482 0.01 . 1 . . . . A 14 DC H5 . 34685 4 91 . 1 . 1 14 14 DC H6 H 1 7.627 0.01 . 1 . . . . A 14 DC H6 . 34685 4 92 . 1 . 1 14 14 DC P P 31 -4.082 0.05 . 1 . . . . A 14 DC P . 34685 4 93 . 1 . 1 15 15 DC P P 31 -3.061 0.05 . 1 . . . . A 15 DC P . 34685 4 94 . 1 . 1 20 20 DA H1' H 1 5.652 0.01 . 1 . . . . A 20 DA H1' . 34685 4 95 . 1 . 1 20 20 DA H2' H 1 2.106 0.01 . 1 . . . . A 20 DA H2' . 34685 4 96 . 1 . 1 20 20 DA H2'' H 1 2.107 0.01 . 1 . . . . A 20 DA H2'' . 34685 4 97 . 1 . 1 20 20 DA H3' H 1 4.462 0.01 . 1 . . . . A 20 DA H3' . 34685 4 98 . 1 . 1 20 20 DA H4' H 1 2.065 0.01 . 1 . . . . A 20 DA H4' . 34685 4 99 . 1 . 1 20 20 DA H5' H 1 3.288 0.01 . 2 . . . . A 20 DA H5' . 34685 4 100 . 1 . 1 20 20 DA H5'' H 1 2.922 0.01 . 2 . . . . A 20 DA H5'' . 34685 4 101 . 1 . 1 20 20 DA H8 H 1 7.769 0.01 . 1 . . . . A 20 DA H8 . 34685 4 102 . 1 . 1 21 21 DA H1' H 1 6.298 0.01 . 1 . . . . A 21 DA H1' . 34685 4 103 . 1 . 1 21 21 DA H2'' H 1 2.917 0.01 . 1 . . . . A 21 DA H2'' . 34685 4 104 . 1 . 1 21 21 DA H3' H 1 4.794 0.01 . 1 . . . . A 21 DA H3' . 34685 4 105 . 1 . 1 21 21 DA H8 H 1 7.917 0.01 . 1 . . . . A 21 DA H8 . 34685 4 106 . 1 . 1 21 21 DA P P 31 -4.562 0.05 . 1 . . . . A 21 DA P . 34685 4 107 . 1 . 1 22 22 DG H1' H 1 5.815 0.01 . 1 . . . . A 22 DG H1' . 34685 4 108 . 1 . 1 22 22 DG H2' H 1 2.505 0.01 . 1 . . . . A 22 DG H2' . 34685 4 109 . 1 . 1 22 22 DG H2'' H 1 2.833 0.01 . 1 . . . . A 22 DG H2'' . 34685 4 110 . 1 . 1 22 22 DG H3' H 1 4.915 0.01 . 1 . . . . A 22 DG H3' . 34685 4 111 . 1 . 1 22 22 DG H4' H 1 4.453 0.01 . 1 . . . . A 22 DG H4' . 34685 4 112 . 1 . 1 22 22 DG H5' H 1 4.319 0.01 . 2 . . . . A 22 DG H5' . 34685 4 113 . 1 . 1 22 22 DG H5'' H 1 4.161 0.01 . 2 . . . . A 22 DG H5'' . 34685 4 114 . 1 . 1 22 22 DG H8 H 1 7.994 0.01 . 1 . . . . A 22 DG H8 . 34685 4 115 . 1 . 1 22 22 DG P P 31 -4.946 0.05 . 1 . . . . A 22 DG P . 34685 4 116 . 1 . 1 23 23 DT H1' H 1 5.999 0.01 . 1 . . . . A 23 DT H1' . 34685 4 117 . 1 . 1 23 23 DT H2' H 1 2.305 0.01 . 1 . . . . A 23 DT H2' . 34685 4 118 . 1 . 1 23 23 DT H2'' H 1 2.542 0.01 . 1 . . . . A 23 DT H2'' . 34685 4 119 . 1 . 1 23 23 DT H3' H 1 4.834 0.01 . 1 . . . . A 23 DT H3' . 34685 4 120 . 1 . 1 23 23 DT H4' H 1 4.364 0.01 . 1 . . . . A 23 DT H4' . 34685 4 121 . 1 . 1 23 23 DT H6 H 1 7.261 0.01 . 1 . . . . A 23 DT H6 . 34685 4 122 . 1 . 1 23 23 DT H71 H 1 1.605 0.01 . 3 . . . . A 23 DT H71 . 34685 4 123 . 1 . 1 23 23 DT H72 H 1 1.605 0.01 . 3 . . . . A 23 DT H72 . 34685 4 124 . 1 . 1 23 23 DT H73 H 1 1.605 0.01 . 3 . . . . A 23 DT H73 . 34685 4 125 . 1 . 1 23 23 DT P P 31 -4.466 0.05 . 1 . . . . A 23 DT P . 34685 4 126 . 1 . 1 24 24 DG H1' H 1 5.941 0.01 . 1 . . . . A 24 DG H1' . 34685 4 127 . 1 . 1 24 24 DG H2' H 1 2.494 0.01 . 1 . . . . A 24 DG H2' . 34685 4 128 . 1 . 1 24 24 DG H2'' H 1 2.769 0.01 . 1 . . . . A 24 DG H2'' . 34685 4 129 . 1 . 1 24 24 DG H3' H 1 5.057 0.01 . 1 . . . . A 24 DG H3' . 34685 4 130 . 1 . 1 24 24 DG H4' H 1 4.481 0.01 . 1 . . . . A 24 DG H4' . 34685 4 131 . 1 . 1 24 24 DG H8 H 1 7.765 0.01 . 1 . . . . A 24 DG H8 . 34685 4 132 . 1 . 1 24 24 DG P P 31 -3.569 0.05 . 1 . . . . A 24 DG P . 34685 4 133 . 1 . 1 25 25 DG H1' H 1 6.024 0.01 . 1 . . . . A 25 DG H1' . 34685 4 134 . 1 . 1 25 25 DG H2' H 1 2.686 0.01 . 1 . . . . A 25 DG H2' . 34685 4 135 . 1 . 1 25 25 DG H2'' H 1 2.816 0.01 . 1 . . . . A 25 DG H2'' . 34685 4 136 . 1 . 1 25 25 DG H3' H 1 5.069 0.01 . 1 . . . . A 25 DG H3' . 34685 4 137 . 1 . 1 25 25 DG H4' H 1 4.524 0.01 . 1 . . . . A 25 DG H4' . 34685 4 138 . 1 . 1 25 25 DG H8 H 1 7.910 0.01 . 1 . . . . A 25 DG H8 . 34685 4 139 . 1 . 1 25 25 DG P P 31 -3.939 0.05 . 1 . . . . A 25 DG P . 34685 4 140 . 1 . 1 26 26 DC H1' H 1 5.987 0.01 . 1 . . . . A 26 DC H1' . 34685 4 141 . 1 . 1 26 26 DC H2' H 1 2.059 0.01 . 1 . . . . A 26 DC H2' . 34685 4 142 . 1 . 1 26 26 DC H2'' H 1 2.457 0.01 . 1 . . . . A 26 DC H2'' . 34685 4 143 . 1 . 1 26 26 DC H3' H 1 4.847 0.01 . 1 . . . . A 26 DC H3' . 34685 4 144 . 1 . 1 26 26 DC H5 H 1 5.361 0.01 . 1 . . . . A 26 DC H5 . 34685 4 145 . 1 . 1 26 26 DC H6 H 1 7.388 0.01 . 1 . . . . A 26 DC H6 . 34685 4 146 . 1 . 1 26 26 DC P P 31 -4.032 0.05 . 1 . . . . A 26 DC P . 34685 4 147 . 1 . 1 27 27 DC H1' H 1 5.651 0.01 . 1 . . . . A 27 DC H1' . 34685 4 148 . 1 . 1 27 27 DC H2' H 1 2.002 0.01 . 1 . . . . A 27 DC H2' . 34685 4 149 . 1 . 1 27 27 DC H2'' H 1 2.347 0.01 . 1 . . . . A 27 DC H2'' . 34685 4 150 . 1 . 1 27 27 DC H3' H 1 4.835 0.01 . 1 . . . . A 27 DC H3' . 34685 4 151 . 1 . 1 27 27 DC H4' H 1 4.108 0.01 . 1 . . . . A 27 DC H4' . 34685 4 152 . 1 . 1 27 27 DC H5 H 1 5.684 0.01 . 1 . . . . A 27 DC H5 . 34685 4 153 . 1 . 1 27 27 DC H6 H 1 7.483 0.01 . 1 . . . . A 27 DC H6 . 34685 4 154 . 1 . 1 27 27 DC P P 31 -4.008 0.05 . 1 . . . . A 27 DC P . 34685 4 155 . 1 . 1 28 28 DG H1' H 1 6.205 0.01 . 1 . . . . A 28 DG H1' . 34685 4 156 . 1 . 1 28 28 DG H2' H 1 2.652 0.01 . 1 . . . . A 28 DG H2' . 34685 4 157 . 1 . 1 28 28 DG H2'' H 1 2.397 0.01 . 1 . . . . A 28 DG H2'' . 34685 4 158 . 1 . 1 28 28 DG H3' H 1 4.705 0.01 . 1 . . . . A 28 DG H3' . 34685 4 159 . 1 . 1 28 28 DG H4' H 1 4.203 0.01 . 1 . . . . A 28 DG H4' . 34685 4 160 . 1 . 1 28 28 DG H8 H 1 7.981 0.01 . 1 . . . . A 28 DG H8 . 34685 4 161 . 1 . 1 28 28 DG P P 31 -3.671 0.05 . 1 . . . . A 28 DG P . 34685 4 stop_ save_ save_assigned_chemical_shifts_5 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_5 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 5 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 17 '2D NOESY' . . . 34685 5 18 '2D 1H-13C HSQC' . . . 34685 5 19 '2D 1H-1H TOCSY' . . . 34685 5 20 '2D 1H-31P COSY' . . . 34685 5 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DC H1' H 1 5.680 0.01 . 1 . . . . A 1 DC H1' . 34685 5 2 . 1 . 1 1 1 DC H2' H 1 1.782 0.01 . 1 . . . . A 1 DC H2' . 34685 5 3 . 1 . 1 1 1 DC H2'' H 1 2.282 0.01 . 1 . . . . A 1 DC H2'' . 34685 5 4 . 1 . 1 1 1 DC H3' H 1 4.633 0.01 . 1 . . . . A 1 DC H3' . 34685 5 5 . 1 . 1 1 1 DC H5 H 1 5.829 0.01 . 1 . . . . A 1 DC H5 . 34685 5 6 . 1 . 1 1 1 DC H6 H 1 7.529 0.01 . 1 . . . . A 1 DC H6 . 34685 5 7 . 1 . 1 2 2 DG H1' H 1 5.405 0.01 . 1 . . . . A 2 DG H1' . 34685 5 8 . 1 . 1 2 2 DG H2' H 1 2.609 0.01 . 1 . . . . A 2 DG H2' . 34685 5 9 . 1 . 1 2 2 DG H2'' H 1 2.632 0.01 . 1 . . . . A 2 DG H2'' . 34685 5 10 . 1 . 1 2 2 DG H3' H 1 4.915 0.01 . 1 . . . . A 2 DG H3' . 34685 5 11 . 1 . 1 2 2 DG H4' H 1 4.244 0.01 . 1 . . . . A 2 DG H4' . 34685 5 12 . 1 . 1 2 2 DG H8 H 1 7.810 0.01 . 1 . . . . A 2 DG H8 . 34685 5 13 . 1 . 1 2 2 DG P P 31 -3.979 0.05 . 1 . . . . A 2 DG P . 34685 5 14 . 1 . 1 3 3 DG H1' H 1 5.771 0.01 . 1 . . . . A 3 DG H1' . 34685 5 15 . 1 . 1 3 3 DG H2' H 1 2.444 0.01 . 1 . . . . A 3 DG H2' . 34685 5 16 . 1 . 1 3 3 DG H2'' H 1 2.488 0.01 . 1 . . . . A 3 DG H2'' . 34685 5 17 . 1 . 1 3 3 DG H3' H 1 4.965 0.01 . 1 . . . . A 3 DG H3' . 34685 5 18 . 1 . 1 3 3 DG H4' H 1 4.362 0.01 . 1 . . . . A 3 DG H4' . 34685 5 19 . 1 . 1 3 3 DG H8 H 1 7.662 0.01 . 1 . . . . A 3 DG H8 . 34685 5 20 . 1 . 1 3 3 DG P P 31 -3.902 0.05 . 1 . . . . A 3 DG P . 34685 5 21 . 1 . 1 4 4 DC H1' H 1 5.392 0.01 . 1 . . . . A 4 DC H1' . 34685 5 22 . 1 . 1 4 4 DC H2' H 1 0.766 0.01 . 1 . . . . A 4 DC H2' . 34685 5 23 . 1 . 1 4 4 DC H2'' H 1 1.525 0.01 . 1 . . . . A 4 DC H2'' . 34685 5 24 . 1 . 1 4 4 DC H3' H 1 4.527 0.01 . 1 . . . . A 4 DC H3' . 34685 5 25 . 1 . 1 4 4 DC H6 H 1 6.558 0.01 . 1 . . . . A 4 DC H6 . 34685 5 26 . 1 . 1 4 4 DC P P 31 -4.064 0.05 . 1 . . . . A 4 DC P . 34685 5 27 . 1 . 1 8 8 DC P P 31 -4.137 0.05 . 1 . . . . A 8 DC P . 34685 5 28 . 1 . 1 9 9 DG H1' H 1 5.719 0.01 . 1 . . . . A 9 DG H1' . 34685 5 29 . 1 . 1 9 9 DG H2' H 1 2.966 0.01 . 1 . . . . A 9 DG H2' . 34685 5 30 . 1 . 1 9 9 DG H2'' H 1 2.804 0.01 . 1 . . . . A 9 DG H2'' . 34685 5 31 . 1 . 1 9 9 DG H3' H 1 5.132 0.01 . 1 . . . . A 9 DG H3' . 34685 5 32 . 1 . 1 9 9 DG H8 H 1 8.445 0.01 . 1 . . . . A 9 DG H8 . 34685 5 33 . 1 . 1 10 10 DA H1' H 1 6.241 0.01 . 1 . . . . A 10 DA H1' . 34685 5 34 . 1 . 1 10 10 DA H2' H 1 2.470 0.01 . 1 . . . . A 10 DA H2' . 34685 5 35 . 1 . 1 10 10 DA H2'' H 1 2.508 0.01 . 1 . . . . A 10 DA H2'' . 34685 5 36 . 1 . 1 10 10 DA H3' H 1 4.787 0.01 . 1 . . . . A 10 DA H3' . 34685 5 37 . 1 . 1 10 10 DA H4' H 1 2.394 0.01 . 1 . . . . A 10 DA H4' . 34685 5 38 . 1 . 1 10 10 DA H5' H 1 3.639 0.01 . 2 . . . . A 10 DA H5' . 34685 5 39 . 1 . 1 10 10 DA H5'' H 1 3.422 0.01 . 2 . . . . A 10 DA H5'' . 34685 5 40 . 1 . 1 10 10 DA H8 H 1 8.376 0.01 . 1 . . . . A 10 DA H8 . 34685 5 41 . 1 . 1 11 11 DA H1' H 1 6.608 0.01 . 1 . . . . A 11 DA H1' . 34685 5 42 . 1 . 1 11 11 DA H2 H 1 8.501 0.01 . 1 . . . . A 11 DA H2 . 34685 5 43 . 1 . 1 11 11 DA H2' H 1 3.256 0.01 . 1 . . . . A 11 DA H2' . 34685 5 44 . 1 . 1 11 11 DA H2'' H 1 3.191 0.01 . 1 . . . . A 11 DA H2'' . 34685 5 45 . 1 . 1 11 11 DA H3' H 1 5.087 0.01 . 1 . . . . A 11 DA H3' . 34685 5 46 . 1 . 1 11 11 DA H8 H 1 8.376 0.01 . 1 . . . . A 11 DA H8 . 34685 5 47 . 1 . 1 12 12 DG H1' H 1 5.782 0.01 . 1 . . . . A 12 DG H1' . 34685 5 48 . 1 . 1 12 12 DG H2' H 1 3.193 0.01 . 1 . . . . A 12 DG H2' . 34685 5 49 . 1 . 1 12 12 DG H2'' H 1 3.194 0.01 . 1 . . . . A 12 DG H2'' . 34685 5 50 . 1 . 1 12 12 DG H3' H 1 5.314 0.01 . 1 . . . . A 12 DG H3' . 34685 5 51 . 1 . 1 12 12 DG H4' H 1 4.780 0.01 . 1 . . . . A 12 DG H4' . 34685 5 52 . 1 . 1 12 12 DG H8 H 1 8.560 0.01 . 1 . . . . A 12 DG H8 . 34685 5 53 . 1 . 1 12 12 DG P P 31 -4.680 0.05 . 1 . . . . A 12 DG P . 34685 5 54 . 1 . 1 13 13 DA H2' H 1 3.404 0.01 . 1 . . . . A 13 DA H2' . 34685 5 55 . 1 . 1 13 13 DA H2'' H 1 3.784 0.01 . 1 . . . . A 13 DA H2'' . 34685 5 56 . 1 . 1 13 13 DA H3' H 1 5.522 0.01 . 1 . . . . A 13 DA H3' . 34685 5 57 . 1 . 1 13 13 DA H4' H 1 4.971 0.01 . 1 . . . . A 13 DA H4' . 34685 5 58 . 1 . 1 13 13 DA H5'' H 1 4.587 0.01 . 2 . . . . A 13 DA H5'' . 34685 5 59 . 1 . 1 13 13 DA H8 H 1 9.098 0.01 . 1 . . . . A 13 DA H8 . 34685 5 60 . 1 . 1 13 13 DA P P 31 -2.755 0.05 . 1 . . . . A 13 DA P . 34685 5 61 . 1 . 1 21 21 DA H1' H 1 6.714 0.01 . 1 . . . . A 21 DA H1' . 34685 5 62 . 1 . 1 21 21 DA H2' H 1 2.982 0.01 . 1 . . . . A 21 DA H2' . 34685 5 63 . 1 . 1 21 21 DA H2'' H 1 3.252 0.01 . 1 . . . . A 21 DA H2'' . 34685 5 64 . 1 . 1 21 21 DA H3' H 1 5.033 0.01 . 1 . . . . A 21 DA H3' . 34685 5 65 . 1 . 1 21 21 DA H8 H 1 8.451 0.01 . 1 . . . . A 21 DA H8 . 34685 5 66 . 1 . 1 22 22 DG H1' H 1 6.099 0.01 . 1 . . . . A 22 DG H1' . 34685 5 67 . 1 . 1 22 22 DG H2' H 1 2.734 0.01 . 1 . . . . A 22 DG H2' . 34685 5 68 . 1 . 1 22 22 DG H2'' H 1 3.045 0.01 . 1 . . . . A 22 DG H2'' . 34685 5 69 . 1 . 1 22 22 DG H3' H 1 5.095 0.01 . 1 . . . . A 22 DG H3' . 34685 5 70 . 1 . 1 22 22 DG H4' H 1 4.677 0.01 . 1 . . . . A 22 DG H4' . 34685 5 71 . 1 . 1 22 22 DG H8 H 1 8.323 0.01 . 1 . . . . A 22 DG H8 . 34685 5 72 . 1 . 1 22 22 DG P P 31 -4.710 0.05 . 1 . . . . A 22 DG P . 34685 5 73 . 1 . 1 23 23 DT H1' H 1 6.181 0.01 . 1 . . . . A 23 DT H1' . 34685 5 74 . 1 . 1 23 23 DT H2' H 1 2.399 0.01 . 1 . . . . A 23 DT H2' . 34685 5 75 . 1 . 1 23 23 DT H2'' H 1 2.683 0.01 . 1 . . . . A 23 DT H2'' . 34685 5 76 . 1 . 1 23 23 DT H3' H 1 4.867 0.01 . 1 . . . . A 23 DT H3' . 34685 5 77 . 1 . 1 23 23 DT H6 H 1 7.419 0.01 . 1 . . . . A 23 DT H6 . 34685 5 78 . 1 . 1 23 23 DT H71 H 1 1.780 0.01 . 3 . . . . A 23 DT H71 . 34685 5 79 . 1 . 1 23 23 DT H72 H 1 1.780 0.01 . 3 . . . . A 23 DT H72 . 34685 5 80 . 1 . 1 23 23 DT H73 H 1 1.780 0.01 . 3 . . . . A 23 DT H73 . 34685 5 81 . 1 . 1 23 23 DT P P 31 -4.336 0.05 . 1 . . . . A 23 DT P . 34685 5 82 . 1 . 1 24 24 DG H1' H 1 5.718 0.01 . 1 . . . . A 24 DG H1' . 34685 5 83 . 1 . 1 24 24 DG H2' H 1 2.291 0.01 . 1 . . . . A 24 DG H2' . 34685 5 84 . 1 . 1 24 24 DG H2'' H 1 2.536 0.01 . 1 . . . . A 24 DG H2'' . 34685 5 85 . 1 . 1 24 24 DG H3' H 1 4.904 0.01 . 1 . . . . A 24 DG H3' . 34685 5 86 . 1 . 1 25 25 DG H1' H 1 5.554 0.01 . 1 . . . . A 25 DG H1' . 34685 5 87 . 1 . 1 25 25 DG H2' H 1 2.400 0.01 . 1 . . . . A 25 DG H2' . 34685 5 88 . 1 . 1 25 25 DG H2'' H 1 2.506 0.01 . 1 . . . . A 25 DG H2'' . 34685 5 89 . 1 . 1 25 25 DG H3' H 1 4.814 0.01 . 1 . . . . A 25 DG H3' . 34685 5 90 . 1 . 1 25 25 DG H4' H 1 4.141 0.01 . 1 . . . . A 25 DG H4' . 34685 5 91 . 1 . 1 25 25 DG H8 H 1 7.615 0.01 . 1 . . . . A 25 DG H8 . 34685 5 92 . 1 . 1 25 25 DG P P 31 -4.210 0.05 . 1 . . . . A 25 DG P . 34685 5 93 . 1 . 1 26 26 DC H1' H 1 5.617 0.01 . 1 . . . . A 26 DC H1' . 34685 5 94 . 1 . 1 26 26 DC H2' H 1 1.815 0.01 . 1 . . . . A 26 DC H2' . 34685 5 95 . 1 . 1 26 26 DC H2'' H 1 2.205 0.01 . 1 . . . . A 26 DC H2'' . 34685 5 96 . 1 . 1 26 26 DC H3' H 1 4.599 0.01 . 1 . . . . A 26 DC H3' . 34685 5 97 . 1 . 1 26 26 DC H4' H 1 3.840 0.01 . 1 . . . . A 26 DC H4' . 34685 5 98 . 1 . 1 26 26 DC H5 H 1 5.102 0.01 . 1 . . . . A 26 DC H5 . 34685 5 99 . 1 . 1 26 26 DC H6 H 1 7.111 0.01 . 1 . . . . A 26 DC H6 . 34685 5 100 . 1 . 1 26 26 DC P P 31 -4.313 0.05 . 1 . . . . A 26 DC P . 34685 5 101 . 1 . 1 27 27 DC H1' H 1 5.466 0.01 . 1 . . . . A 27 DC H1' . 34685 5 102 . 1 . 1 27 27 DC H2' H 1 1.843 0.01 . 1 . . . . A 27 DC H2' . 34685 5 103 . 1 . 1 27 27 DC H2'' H 1 2.204 0.01 . 1 . . . . A 27 DC H2'' . 34685 5 104 . 1 . 1 27 27 DC H3' H 1 4.681 0.01 . 1 . . . . A 27 DC H3' . 34685 5 105 . 1 . 1 27 27 DC H4' H 1 3.903 0.01 . 1 . . . . A 27 DC H4' . 34685 5 106 . 1 . 1 27 27 DC H5 H 1 5.502 0.01 . 1 . . . . A 27 DC H5 . 34685 5 107 . 1 . 1 27 27 DC H6 H 1 7.295 0.01 . 1 . . . . A 27 DC H6 . 34685 5 108 . 1 . 1 27 27 DC P P 31 -4.247 0.05 . 1 . . . . A 27 DC P . 34685 5 109 . 1 . 1 28 28 DG H1' H 1 6.105 0.01 . 1 . . . . A 28 DG H1' . 34685 5 110 . 1 . 1 28 28 DG H2' H 1 2.564 0.01 . 1 . . . . A 28 DG H2' . 34685 5 111 . 1 . 1 28 28 DG H2'' H 1 2.318 0.01 . 1 . . . . A 28 DG H2'' . 34685 5 112 . 1 . 1 28 28 DG H3' H 1 4.621 0.01 . 1 . . . . A 28 DG H3' . 34685 5 113 . 1 . 1 28 28 DG H4' H 1 4.101 0.01 . 1 . . . . A 28 DG H4' . 34685 5 114 . 1 . 1 28 28 DG H8 H 1 7.870 0.01 . 1 . . . . A 28 DG H8 . 34685 5 115 . 1 . 1 28 28 DG P P 31 -3.798 0.05 . 1 . . . . A 28 DG P . 34685 5 stop_ save_ save_assigned_chemical_shifts_6 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_6 _Assigned_chem_shift_list.Entry_ID 34685 _Assigned_chem_shift_list.ID 6 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 21 '2D NOESY' . . . 34685 6 22 '2D 1H-1H TOCSY' . . . 34685 6 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 2 2 DG H1 H 1 13.243 0.01 . 1 . . . . A 2 DG H1 . 34685 6 2 . 1 . 1 3 3 DG H1 H 1 13.030 0.01 . 1 . . . . A 3 DG H1 . 34685 6 3 . 1 . 1 4 4 DC H41 H 1 8.154 0.01 . 1 . . . . A 4 DC H41 . 34685 6 4 . 1 . 1 4 4 DC H42 H 1 6.514 0.01 . 1 . . . . A 4 DC H42 . 34685 6 5 . 1 . 1 5 5 DC H41 H 1 7.904 0.01 . 1 . . . . A 5 DC H41 . 34685 6 6 . 1 . 1 5 5 DC H42 H 1 7.114 0.01 . 1 . . . . A 5 DC H42 . 34685 6 7 . 1 . 1 6 6 DG H1 H 1 13.357 0.01 . 1 . . . . A 6 DG H1 . 34685 6 8 . 1 . 1 6 6 DG H21 H 1 9.302 0.01 . 1 . . . . A 6 DG H21 . 34685 6 9 . 1 . 1 6 6 DG H22 H 1 5.725 0.01 . 1 . . . . A 6 DG H22 . 34685 6 10 . 1 . 1 7 7 DT H3 H 1 13.672 0.01 . 1 . . . . A 7 DT H3 . 34685 6 11 . 1 . 1 8 8 DC H41 H 1 8.614 0.01 . 1 . . . . A 8 DC H41 . 34685 6 12 . 1 . 1 8 8 DC H42 H 1 7.156 0.01 . 1 . . . . A 8 DC H42 . 34685 6 13 . 1 . 1 12 12 DG H1 H 1 12.962 0.01 . 1 . . . . A 12 DG H1 . 34685 6 14 . 1 . 1 14 14 DC H41 H 1 8.201 0.01 . 1 . . . . A 14 DC H41 . 34685 6 15 . 1 . 1 14 14 DC H42 H 1 6.737 0.01 . 1 . . . . A 14 DC H42 . 34685 6 16 . 1 . 1 17 17 DG H1 H 1 10.719 0.01 . 1 . . . . A 17 DG H1 . 34685 6 17 . 1 . 1 18 18 DC H41 H 1 8.329 0.01 . 1 . . . . A 18 DC H41 . 34685 6 18 . 1 . 1 18 18 DC H42 H 1 7.377 0.01 . 1 . . . . A 18 DC H42 . 34685 6 19 . 1 . 1 22 22 DG H1 H 1 12.972 0.01 . 1 . . . . A 22 DG H1 . 34685 6 20 . 1 . 1 23 23 DT H3 H 1 11.991 0.01 . 1 . . . . A 23 DT H3 . 34685 6 21 . 1 . 1 24 24 DG H1 H 1 12.301 0.01 . 1 . . . . A 24 DG H1 . 34685 6 22 . 1 . 1 25 25 DG H1 H 1 12.993 0.01 . 1 . . . . A 25 DG H1 . 34685 6 23 . 1 . 1 26 26 DC H41 H 1 8.165 0.01 . 1 . . . . A 26 DC H41 . 34685 6 24 . 1 . 1 26 26 DC H42 H 1 6.352 0.01 . 1 . . . . A 26 DC H42 . 34685 6 25 . 1 . 1 27 27 DC H41 H 1 8.699 0.01 . 1 . . . . A 27 DC H41 . 34685 6 26 . 1 . 1 27 27 DC H42 H 1 6.992 0.01 . 1 . . . . A 27 DC H42 . 34685 6 stop_ save_