data_34880 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 34880 _Entry.Title ; A quadruplex-duplex hybrid with a three-layered hybrid-2 G-quadruplex topology ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2023-11-22 _Entry.Accession_date 2023-11-22 _Entry.Last_release_date 2024-01-11 _Entry.Original_release_date 2024-01-11 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Y. Vianney Y. M. . . 34880 2 K. Weisz K. . . . 34880 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID '(3+1) hybrid' . 34880 DNA . 34880 G-quadruplex . 34880 'Quadruplex-duplex hybrid' . 34880 hybrid-2 . 34880 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 34880 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 45 34880 '1H chemical shifts' 207 34880 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2024-03-14 2023-11-22 update BMRB 'update entry citation' 34880 1 . . 2024-02-26 2023-11-22 original author 'original release' 34880 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 8R6D 'BMRB Entry Tracking System' 34880 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 34880 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 38477454 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Adv. Sci. (Weinh)' _Citation.Journal_name_full 'Advanced science (Weinheim, Baden-Wurttemberg, Germany)' _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN 2198-3844 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first e2309891 _Citation.Page_last e2309891 _Citation.Year 2024 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Y. Vianney Y. M. . . 34880 1 2 D. Dierks D. . . . 34880 1 3 K. Weisz K. . . . 34880 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 34880 _Assembly.ID 1 _Assembly.Name 'DNA (31-MER)' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 unit_1 1 $entity_1 A A yes . . . . . . 34880 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 34880 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGGCGCGAAGCATTCGCGGG GTTAGGGTGGG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 31 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 9771.240 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 34880 1 2 . DG . 34880 1 3 . DG . 34880 1 4 . DC . 34880 1 5 . DG . 34880 1 6 . DC . 34880 1 7 . DG . 34880 1 8 . DA . 34880 1 9 . DA . 34880 1 10 . DG . 34880 1 11 . DC . 34880 1 12 . DA . 34880 1 13 . DT . 34880 1 14 . DT . 34880 1 15 . DC . 34880 1 16 . DG . 34880 1 17 . DC . 34880 1 18 . DG . 34880 1 19 . DG . 34880 1 20 . DG . 34880 1 21 . DG . 34880 1 22 . DT . 34880 1 23 . DT . 34880 1 24 . DA . 34880 1 25 . DG . 34880 1 26 . DG . 34880 1 27 . DG . 34880 1 28 . DT . 34880 1 29 . DG . 34880 1 30 . DG . 34880 1 31 . DG . 34880 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 34880 1 . DG 2 2 34880 1 . DG 3 3 34880 1 . DC 4 4 34880 1 . DG 5 5 34880 1 . DC 6 6 34880 1 . DG 7 7 34880 1 . DA 8 8 34880 1 . DA 9 9 34880 1 . DG 10 10 34880 1 . DC 11 11 34880 1 . DA 12 12 34880 1 . DT 13 13 34880 1 . DT 14 14 34880 1 . DC 15 15 34880 1 . DG 16 16 34880 1 . DC 17 17 34880 1 . DG 18 18 34880 1 . DG 19 19 34880 1 . DG 20 20 34880 1 . DG 21 21 34880 1 . DT 22 22 34880 1 . DT 23 23 34880 1 . DA 24 24 34880 1 . DG 25 25 34880 1 . DG 26 26 34880 1 . DG 27 27 34880 1 . DT 28 28 34880 1 . DG 29 29 34880 1 . DG 30 30 34880 1 . DG 31 31 34880 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 34880 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32630 'no natural source' . 'synthetic construct' . . . . . synthetic construct . . . . . . . . . . . . . 34880 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 34880 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 34880 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 34880 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '1 mM DNA (31-MER), 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (31-MER)' 'natural abundance' 1 $assembly 1 $entity_1 . . 1 . . mM . . . . 34880 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 34880 _Sample.ID 2 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.2 mM [U-10% 13C; U-10% 15N]-Gua DNA (31-MER), 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (31-MER)' '[U-10% 13C; U-10% 15N]-Gua' 1 $assembly 1 $entity_1 . . 0.2 . . mM . . . . 34880 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 34880 _Sample.ID 3 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details '0.2 mM [U-10% 15N]-Gua DNA (31-MER), 90% H2O/10% D2O' _Sample.Aggregate_sample_number . _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'DNA (31-MER)' '[U-10% 15N]-Gua' 1 $assembly 1 $entity_1 . . 0.2 . . mM . . . . 34880 3 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 34880 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 120 . mM 34880 1 pH 7.0 . pH 34880 1 pressure 1 . atm 34880 1 temperature 298 . K 34880 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 34880 _Software.ID 1 _Software.Type . _Software.Name 'CcpNmr Analysis' _Software.Version 2.4.2 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID CCPN . . 34880 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 34880 1 'peak picking' . 34880 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 34880 _Software.ID 2 _Software.Type . _Software.Name Amber _Software.Version 18 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 34880 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 34880 2 'structure calculation' . 34880 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 34880 _Software.ID 3 _Software.Type . _Software.Name TopSpin _Software.Version 4.0.7 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 34880 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 34880 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 34880 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list _NMR_spectrometer_list.Entry_ID 34880 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE NEO' . 600 . . . 34880 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 34880 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34880 1 2 '2D DQF-COSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34880 1 3 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 34880 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 34880 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl carbons' . . . . ppm 4.78 internal indirect 0.25144953 . . . . . 34880 1 H 1 TSP protons . . . . ppm 4.78 internal direct 1 . . . . . 34880 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 34880 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 34880 1 2 '2D DQF-COSY' . . . 34880 1 3 '2D 1H-13C HSQC' . . . 34880 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1 H 1 11.927 0.002 . 1 . . 670 . A 1 DG H1 . 34880 1 2 . 1 . 1 1 1 DG H1' H 1 6.128 0.003 . 1 . . 467 . A 1 DG H1' . 34880 1 3 . 1 . 1 1 1 DG H2' H 1 2.904 0.004 . 1 . . 542 . A 1 DG H2' . 34880 1 4 . 1 . 1 1 1 DG H2'' H 1 3.196 0.003 . 1 . . 543 . A 1 DG H2'' . 34880 1 5 . 1 . 1 1 1 DG H3' H 1 4.988 0.004 . 1 . . 626 . A 1 DG H3' . 34880 1 6 . 1 . 1 1 1 DG H8 H 1 7.488 0.002 . 1 . . 468 . A 1 DG H8 . 34880 1 7 . 1 . 1 1 1 DG C5 C 13 119.311 0.017 . 1 . . 675 . A 1 DG C5 . 34880 1 8 . 1 . 1 1 1 DG C8 C 13 141.946 . . 1 . . 601 . A 1 DG C8 . 34880 1 9 . 1 . 1 2 2 DG H1 H 1 11.672 0.004 . 1 . . 665 . A 2 DG H1 . 34880 1 10 . 1 . 1 2 2 DG H1' H 1 5.987 0.003 . 1 . . 466 . A 2 DG H1' . 34880 1 11 . 1 . 1 2 2 DG H2' H 1 2.575 0.006 . 1 . . 553 . A 2 DG H2' . 34880 1 12 . 1 . 1 2 2 DG H2'' H 1 2.908 0.004 . 1 . . 554 . A 2 DG H2'' . 34880 1 13 . 1 . 1 2 2 DG H3' H 1 5.099 0.004 . 1 . . 621 . A 2 DG H3' . 34880 1 14 . 1 . 1 2 2 DG H8 H 1 8.036 0.001 . 1 . . 465 . A 2 DG H8 . 34880 1 15 . 1 . 1 2 2 DG C8 C 13 138.913 . . 1 . . 593 . A 2 DG C8 . 34880 1 16 . 1 . 1 3 3 DG H1 H 1 10.845 0.003 . 1 . . 663 . A 3 DG H1 . 34880 1 17 . 1 . 1 3 3 DG H1' H 1 5.906 0.003 . 1 . . 485 . A 3 DG H1' . 34880 1 18 . 1 . 1 3 3 DG H2' H 1 2.514 0.002 . 1 . . 556 . A 3 DG H2' . 34880 1 19 . 1 . 1 3 3 DG H2'' H 1 2.595 0.003 . 1 . . 557 . A 3 DG H2'' . 34880 1 20 . 1 . 1 3 3 DG H3' H 1 4.995 0.002 . 1 . . 622 . A 3 DG H3' . 34880 1 21 . 1 . 1 3 3 DG H8 H 1 7.711 0.002 . 1 . . 484 . A 3 DG H8 . 34880 1 22 . 1 . 1 3 3 DG C8 C 13 138.056 . . 1 . . 689 . A 3 DG C8 . 34880 1 23 . 1 . 1 4 4 DC H1' H 1 5.929 0.006 . 1 . . 483 . A 4 DC H1' . 34880 1 24 . 1 . 1 4 4 DC H2' H 1 2.035 0.001 . 1 . . 558 . A 4 DC H2' . 34880 1 25 . 1 . 1 4 4 DC H2'' H 1 2.427 0.001 . 1 . . 559 . A 4 DC H2'' . 34880 1 26 . 1 . 1 4 4 DC H3' H 1 4.921 0.002 . 1 . . 643 . A 4 DC H3' . 34880 1 27 . 1 . 1 4 4 DC H5 H 1 5.363 0.002 . 1 . . 459 . A 4 DC H5 . 34880 1 28 . 1 . 1 4 4 DC H6 H 1 7.440 0.002 . 1 . . 473 . A 4 DC H6 . 34880 1 29 . 1 . 1 4 4 DC H41 H 1 8.161 0.001 . 1 . . 458 . A 4 DC H41 . 34880 1 30 . 1 . 1 4 4 DC H42 H 1 6.220 0.002 . 1 . . 460 . A 4 DC H42 . 34880 1 31 . 1 . 1 4 4 DC C6 C 13 142.914 . . 1 . . 608 . A 4 DC C6 . 34880 1 32 . 1 . 1 5 5 DG H1 H 1 12.790 0.002 . 1 . . 661 . A 5 DG H1 . 34880 1 33 . 1 . 1 5 5 DG H1' H 1 5.768 0.002 . 1 . . 479 . A 5 DG H1' . 34880 1 34 . 1 . 1 5 5 DG H2' H 1 2.580 0.004 . 1 . . 545 . A 5 DG H2' . 34880 1 35 . 1 . 1 5 5 DG H2'' H 1 2.659 0.002 . 1 . . 546 . A 5 DG H2'' . 34880 1 36 . 1 . 1 5 5 DG H3' H 1 4.940 0.004 . 1 . . 642 . A 5 DG H3' . 34880 1 37 . 1 . 1 5 5 DG H8 H 1 7.836 0.003 . 1 . . 481 . A 5 DG H8 . 34880 1 38 . 1 . 1 5 5 DG C8 C 13 138.015 . . 1 . . 692 . A 5 DG C8 . 34880 1 39 . 1 . 1 6 6 DC H1' H 1 5.497 0.002 . 1 . . 472 . A 6 DC H1' . 34880 1 40 . 1 . 1 6 6 DC H2' H 1 1.775 0.002 . 1 . . 560 . A 6 DC H2' . 34880 1 41 . 1 . 1 6 6 DC H2'' H 1 2.217 0.002 . 1 . . 561 . A 6 DC H2'' . 34880 1 42 . 1 . 1 6 6 DC H3' H 1 4.739 0.001 . 1 . . 639 . A 6 DC H3' . 34880 1 43 . 1 . 1 6 6 DC H5 H 1 5.320 0.004 . 1 . . 457 . A 6 DC H5 . 34880 1 44 . 1 . 1 6 6 DC H6 H 1 7.170 0.002 . 1 . . 474 . A 6 DC H6 . 34880 1 45 . 1 . 1 6 6 DC H41 H 1 8.240 0.001 . 1 . . 455 . A 6 DC H41 . 34880 1 46 . 1 . 1 6 6 DC H42 H 1 6.315 0.003 . 1 . . 456 . A 6 DC H42 . 34880 1 47 . 1 . 1 6 6 DC C6 C 13 142.151 . . 1 . . 604 . A 6 DC C6 . 34880 1 48 . 1 . 1 7 7 DG H1 H 1 12.695 0.002 . 1 . . 659 . A 7 DG H1 . 34880 1 49 . 1 . 1 7 7 DG H1' H 1 5.341 0.003 . 1 . . 470 . A 7 DG H1' . 34880 1 50 . 1 . 1 7 7 DG H2' H 1 2.575 0.004 . 1 . . 564 . A 7 DG H2' . 34880 1 51 . 1 . 1 7 7 DG H2'' H 1 2.653 0.003 . 1 . . 565 . A 7 DG H2'' . 34880 1 52 . 1 . 1 7 7 DG H3' H 1 4.912 0.001 . 1 . . 644 . A 7 DG H3' . 34880 1 53 . 1 . 1 7 7 DG H8 H 1 7.798 0.002 . 1 . . 471 . A 7 DG H8 . 34880 1 54 . 1 . 1 7 7 DG C8 C 13 138.245 . . 1 . . 691 . A 7 DG C8 . 34880 1 55 . 1 . 1 8 8 DA H1' H 1 5.852 0.003 . 1 . . 478 . A 8 DA H1' . 34880 1 56 . 1 . 1 8 8 DA H2 H 1 7.540 0.002 . 1 . . 650 . A 8 DA H2 . 34880 1 57 . 1 . 1 8 8 DA H2' H 1 2.262 0.002 . 1 . . 568 . A 8 DA H2' . 34880 1 58 . 1 . 1 8 8 DA H2'' H 1 2.578 0.002 . 1 . . 572 . A 8 DA H2'' . 34880 1 59 . 1 . 1 8 8 DA H3' H 1 4.923 0.002 . 1 . . 645 . A 8 DA H3' . 34880 1 60 . 1 . 1 8 8 DA H8 H 1 7.867 0.001 . 1 . . 469 . A 8 DA H8 . 34880 1 61 . 1 . 1 8 8 DA C2 C 13 154.472 . . 1 . . 654 . A 8 DA C2 . 34880 1 62 . 1 . 1 8 8 DA C8 C 13 140.957 . . 1 . . 596 . A 8 DA C8 . 34880 1 63 . 1 . 1 9 9 DA H1' H 1 5.853 0.002 . 1 . . 464 . A 9 DA H1' . 34880 1 64 . 1 . 1 9 9 DA H2 H 1 7.672 0.003 . 1 . . 652 . A 9 DA H2 . 34880 1 65 . 1 . 1 9 9 DA H2' H 1 2.027 0.003 . 1 . . 567 . A 9 DA H2' . 34880 1 66 . 1 . 1 9 9 DA H2'' H 1 2.391 0.001 . 1 . . 569 . A 9 DA H2'' . 34880 1 67 . 1 . 1 9 9 DA H3' H 1 4.852 0.001 . 1 . . 646 . A 9 DA H3' . 34880 1 68 . 1 . 1 9 9 DA H8 H 1 7.420 0.001 . 1 . . 477 . A 9 DA H8 . 34880 1 69 . 1 . 1 9 9 DA C2 C 13 155.016 . . 1 . . 1336 . A 9 DA C2 . 34880 1 70 . 1 . 1 9 9 DA C8 C 13 139.858 . . 1 . . 696 . A 9 DA C8 . 34880 1 71 . 1 . 1 10 10 DG H1' H 1 5.355 0.003 . 1 . . 462 . A 10 DG H1' . 34880 1 72 . 1 . 1 10 10 DG H2' H 1 2.603 0.003 . 1 . . 571 . A 10 DG H2' . 34880 1 73 . 1 . 1 10 10 DG H2'' H 1 2.320 0.002 . 1 . . 570 . A 10 DG H2'' . 34880 1 74 . 1 . 1 10 10 DG H3' H 1 4.788 0.0 . 1 . . 647 . A 10 DG H3' . 34880 1 75 . 1 . 1 10 10 DG H8 H 1 8.020 0.002 . 1 . . 461 . A 10 DG H8 . 34880 1 76 . 1 . 1 10 10 DG C8 C 13 138.968 . . 1 . . 594 . A 10 DG C8 . 34880 1 77 . 1 . 1 11 11 DC H1' H 1 5.670 0.003 . 1 . . 463 . A 11 DC H1' . 34880 1 78 . 1 . 1 11 11 DC H2' H 1 1.569 0.004 . 1 . . 574 . A 11 DC H2' . 34880 1 79 . 1 . 1 11 11 DC H2'' H 1 2.018 0.002 . 1 . . 573 . A 11 DC H2'' . 34880 1 80 . 1 . 1 11 11 DC H3' H 1 4.387 0.001 . 1 . . 648 . A 11 DC H3' . 34880 1 81 . 1 . 1 11 11 DC H5 H 1 5.179 0.002 . 1 . . 476 . A 11 DC H5 . 34880 1 82 . 1 . 1 11 11 DC H6 H 1 7.161 0.003 . 1 . . 475 . A 11 DC H6 . 34880 1 83 . 1 . 1 11 11 DC C6 C 13 143.455 . . 1 . . 605 . A 11 DC C6 . 34880 1 84 . 1 . 1 12 12 DA H1' H 1 6.290 0.002 . 1 . . 451 . A 12 DA H1' . 34880 1 85 . 1 . 1 12 12 DA H2 H 1 8.015 0.002 . 1 . . 655 . A 12 DA H2 . 34880 1 86 . 1 . 1 12 12 DA H2' H 1 2.979 0.002 . 1 . . 541 . A 12 DA H2' . 34880 1 87 . 1 . 1 12 12 DA H2'' H 1 2.920 0.003 . 1 . . 540 . A 12 DA H2'' . 34880 1 88 . 1 . 1 12 12 DA H3' H 1 4.793 0.002 . 1 . . 627 . A 12 DA H3' . 34880 1 89 . 1 . 1 12 12 DA H8 H 1 8.057 0.002 . 1 . . 450 . A 12 DA H8 . 34880 1 90 . 1 . 1 12 12 DA C2 C 13 155.474 . . 1 . . 656 . A 12 DA C2 . 34880 1 91 . 1 . 1 12 12 DA C8 C 13 143.128 . . 1 . . 592 . A 12 DA C8 . 34880 1 92 . 1 . 1 13 13 DT H1' H 1 5.650 0.004 . 1 . . 499 . A 13 DT H1' . 34880 1 93 . 1 . 1 13 13 DT H2' H 1 2.081 0.002 . 1 . . 575 . A 13 DT H2' . 34880 1 94 . 1 . 1 13 13 DT H2'' H 1 2.476 0.002 . 1 . . 576 . A 13 DT H2'' . 34880 1 95 . 1 . 1 13 13 DT H3 H 1 13.282 0.0 . 1 . . 674 . A 13 DT H3 . 34880 1 96 . 1 . 1 13 13 DT H3' H 1 4.736 0.001 . 1 . . 640 . A 13 DT H3' . 34880 1 97 . 1 . 1 13 13 DT H6 H 1 7.377 0.001 . 1 . . 495 . A 13 DT H6 . 34880 1 98 . 1 . 1 13 13 DT H71 H 1 1.808 0.002 . 1 . . 497 . A 13 DT H71 . 34880 1 99 . 1 . 1 13 13 DT H72 H 1 1.808 0.002 . 1 . . 497 . A 13 DT H72 . 34880 1 100 . 1 . 1 13 13 DT H73 H 1 1.808 0.002 . 1 . . 497 . A 13 DT H73 . 34880 1 101 . 1 . 1 13 13 DT C6 C 13 139.349 . . 1 . . 607 . A 13 DT C6 . 34880 1 102 . 1 . 1 14 14 DT H1' H 1 6.018 0.003 . 1 . . 500 . A 14 DT H1' . 34880 1 103 . 1 . 1 14 14 DT H2' H 1 2.151 0.004 . 1 . . 578 . A 14 DT H2' . 34880 1 104 . 1 . 1 14 14 DT H2'' H 1 2.437 0.0 . 1 . . 577 . A 14 DT H2'' . 34880 1 105 . 1 . 1 14 14 DT H3 H 1 13.863 0.003 . 1 . . 651 . A 14 DT H3 . 34880 1 106 . 1 . 1 14 14 DT H3' H 1 4.838 0.002 . 1 . . 641 . A 14 DT H3' . 34880 1 107 . 1 . 1 14 14 DT H6 H 1 7.386 0.001 . 1 . . 498 . A 14 DT H6 . 34880 1 108 . 1 . 1 14 14 DT H71 H 1 1.590 0.002 . 1 . . 496 . A 14 DT H71 . 34880 1 109 . 1 . 1 14 14 DT H72 H 1 1.590 0.002 . 1 . . 496 . A 14 DT H72 . 34880 1 110 . 1 . 1 14 14 DT H73 H 1 1.590 0.002 . 1 . . 496 . A 14 DT H73 . 34880 1 111 . 1 . 1 14 14 DT C6 C 13 139.854 . . 1 . . 687 . A 14 DT C6 . 34880 1 112 . 1 . 1 15 15 DC H1' H 1 5.525 0.002 . 1 . . 490 . A 15 DC H1' . 34880 1 113 . 1 . 1 15 15 DC H2' H 1 1.970 0.003 . 1 . . 579 . A 15 DC H2' . 34880 1 114 . 1 . 1 15 15 DC H2'' H 1 2.265 0.003 . 1 . . 580 . A 15 DC H2'' . 34880 1 115 . 1 . 1 15 15 DC H3' H 1 4.775 0.0 . 1 . . 649 . A 15 DC H3' . 34880 1 116 . 1 . 1 15 15 DC H5 H 1 5.616 0.003 . 1 . . 447 . A 15 DC H5 . 34880 1 117 . 1 . 1 15 15 DC H6 H 1 7.420 0.002 . 1 . . 491 . A 15 DC H6 . 34880 1 118 . 1 . 1 15 15 DC H41 H 1 8.479 0.002 . 1 . . 445 . A 15 DC H41 . 34880 1 119 . 1 . 1 15 15 DC H42 H 1 6.854 0.002 . 1 . . 446 . A 15 DC H42 . 34880 1 120 . 1 . 1 15 15 DC C6 C 13 143.559 . . 1 . . 610 . A 15 DC C6 . 34880 1 121 . 1 . 1 16 16 DG H1 H 1 12.745 0.003 . 1 . . 662 . A 16 DG H1 . 34880 1 122 . 1 . 1 16 16 DG H1' H 1 5.611 0.003 . 1 . . 489 . A 16 DG H1' . 34880 1 123 . 1 . 1 16 16 DG H2' H 1 2.397 0.002 . 1 . . 581 . A 16 DG H2' . 34880 1 124 . 1 . 1 16 16 DG H2'' H 1 2.398 0.001 . 1 . . 582 . A 16 DG H2'' . 34880 1 125 . 1 . 1 16 16 DG H3' H 1 4.784 0.002 . 1 . . 620 . A 16 DG H3' . 34880 1 126 . 1 . 1 16 16 DG H8 H 1 7.708 0.001 . 1 . . 488 . A 16 DG H8 . 34880 1 127 . 1 . 1 16 16 DG C8 C 13 138.047 . . 1 . . 695 . A 16 DG C8 . 34880 1 128 . 1 . 1 17 17 DC H1' H 1 5.498 0.002 . 1 . . 493 . A 17 DC H1' . 34880 1 129 . 1 . 1 17 17 DC H2' H 1 1.591 0.003 . 1 . . 563 . A 17 DC H2' . 34880 1 130 . 1 . 1 17 17 DC H2'' H 1 2.041 0.003 . 1 . . 562 . A 17 DC H2'' . 34880 1 131 . 1 . 1 17 17 DC H3' H 1 4.545 . . 1 . . 638 . A 17 DC H3' . 34880 1 132 . 1 . 1 17 17 DC H5 H 1 5.120 0.002 . 1 . . 525 . A 17 DC H5 . 34880 1 133 . 1 . 1 17 17 DC H6 H 1 7.011 0.002 . 1 . . 501 . A 17 DC H6 . 34880 1 134 . 1 . 1 17 17 DC H41 H 1 7.991 0.001 . 1 . . 524 . A 17 DC H41 . 34880 1 135 . 1 . 1 17 17 DC H42 H 1 5.995 0.003 . 1 . . 502 . A 17 DC H42 . 34880 1 136 . 1 . 1 17 17 DC C6 C 13 142.825 . . 1 . . 603 . A 17 DC C6 . 34880 1 137 . 1 . 1 18 18 DG H1 H 1 13.102 0.002 . 1 . . 660 . A 18 DG H1 . 34880 1 138 . 1 . 1 18 18 DG H1' H 1 5.668 0.001 . 1 . . 494 . A 18 DG H1' . 34880 1 139 . 1 . 1 18 18 DG H2' H 1 2.371 0.002 . 1 . . 530 . A 18 DG H2' . 34880 1 140 . 1 . 1 18 18 DG H2'' H 1 2.797 0.0 . 1 . . 531 . A 18 DG H2'' . 34880 1 141 . 1 . 1 18 18 DG H3' H 1 4.838 . . 1 . . 637 . A 18 DG H3' . 34880 1 142 . 1 . 1 18 18 DG H8 H 1 7.490 0.002 . 1 . . 492 . A 18 DG H8 . 34880 1 143 . 1 . 1 18 18 DG C5 C 13 117.214 . . 1 . . 615 . A 18 DG C5 . 34880 1 144 . 1 . 1 18 18 DG C8 C 13 137.640 . . 1 . . 599 . A 18 DG C8 . 34880 1 145 . 1 . 1 19 19 DG H1 H 1 11.003 0.003 . 1 . . 673 . A 19 DG H1 . 34880 1 146 . 1 . 1 19 19 DG H1' H 1 5.909 0.003 . 1 . . 516 . A 19 DG H1' . 34880 1 147 . 1 . 1 19 19 DG H2' H 1 3.041 0.002 . 1 . . 584 . A 19 DG H2' . 34880 1 148 . 1 . 1 19 19 DG H2'' H 1 2.769 0.003 . 1 . . 583 . A 19 DG H2'' . 34880 1 149 . 1 . 1 19 19 DG H3' H 1 4.843 0.002 . 1 . . 636 . A 19 DG H3' . 34880 1 150 . 1 . 1 19 19 DG H8 H 1 7.247 0.003 . 1 . . 515 . A 19 DG H8 . 34880 1 151 . 1 . 1 19 19 DG C5 C 13 118.105 0.006 . 1 . . 681 . A 19 DG C5 . 34880 1 152 . 1 . 1 19 19 DG C8 C 13 141.946 . . 1 . . 602 . A 19 DG C8 . 34880 1 153 . 1 . 1 20 20 DG H1 H 1 11.098 0.002 . 1 . . 672 . A 20 DG H1 . 34880 1 154 . 1 . 1 20 20 DG H1' H 1 5.682 0.003 . 1 . . 487 . A 20 DG H1' . 34880 1 155 . 1 . 1 20 20 DG H2' H 1 2.648 0.001 . 1 . . 585 . A 20 DG H2' . 34880 1 156 . 1 . 1 20 20 DG H2'' H 1 2.492 0.003 . 1 . . 586 . A 20 DG H2'' . 34880 1 157 . 1 . 1 20 20 DG H3' H 1 4.938 0.002 . 1 . . 623 . A 20 DG H3' . 34880 1 158 . 1 . 1 20 20 DG H8 H 1 7.195 0.004 . 1 . . 517 . A 20 DG H8 . 34880 1 159 . 1 . 1 20 20 DG C5 C 13 118.383 0.022 . 1 . . 678 . A 20 DG C5 . 34880 1 160 . 1 . 1 20 20 DG C8 C 13 141.076 . . 1 . . 606 . A 20 DG C8 . 34880 1 161 . 1 . 1 21 21 DG H1 H 1 11.174 0.004 . 1 . . 612 . A 21 DG H1 . 34880 1 162 . 1 . 1 21 21 DG H1' H 1 5.908 0.004 . 1 . . 518 . A 21 DG H1' . 34880 1 163 . 1 . 1 21 21 DG H2' H 1 2.587 0.005 . 1 . . 588 . A 21 DG H2' . 34880 1 164 . 1 . 1 21 21 DG H2'' H 1 2.506 0.003 . 1 . . 589 . A 21 DG H2'' . 34880 1 165 . 1 . 1 21 21 DG H3' H 1 5.090 0.002 . 1 . . 624 . A 21 DG H3' . 34880 1 166 . 1 . 1 21 21 DG H8 H 1 7.762 0.002 . 1 . . 486 . A 21 DG H8 . 34880 1 167 . 1 . 1 21 21 DG C5 C 13 116.619 0.009 . 1 . . 611 . A 21 DG C5 . 34880 1 168 . 1 . 1 21 21 DG C8 C 13 138.035 . . 1 . . 688 . A 21 DG C8 . 34880 1 169 . 1 . 1 22 22 DT H1' H 1 6.280 0.003 . 1 . . 504 . A 22 DT H1' . 34880 1 170 . 1 . 1 22 22 DT H2' H 1 2.299 0.005 . 1 . . 539 . A 22 DT H2' . 34880 1 171 . 1 . 1 22 22 DT H2'' H 1 2.502 0.004 . 1 . . 538 . A 22 DT H2'' . 34880 1 172 . 1 . 1 22 22 DT H3' H 1 4.844 0.002 . 1 . . 634 . A 22 DT H3' . 34880 1 173 . 1 . 1 22 22 DT H6 H 1 7.833 0.002 . 1 . . 503 . A 22 DT H6 . 34880 1 174 . 1 . 1 22 22 DT H71 H 1 1.959 . . 1 . . 507 . A 22 DT H71 . 34880 1 175 . 1 . 1 22 22 DT H72 H 1 1.959 . . 1 . . 507 . A 22 DT H72 . 34880 1 176 . 1 . 1 22 22 DT H73 H 1 1.959 . . 1 . . 507 . A 22 DT H73 . 34880 1 177 . 1 . 1 22 22 DT C6 C 13 140.055 . . 1 . . 598 . A 22 DT C6 . 34880 1 178 . 1 . 1 23 23 DT H1' H 1 5.778 0.003 . 1 . . 480 . A 23 DT H1' . 34880 1 179 . 1 . 1 23 23 DT H2' H 1 1.204 0.002 . 1 . . 449 . A 23 DT H2' . 34880 1 180 . 1 . 1 23 23 DT H2'' H 1 1.766 0.002 . 1 . . 544 . A 23 DT H2'' . 34880 1 181 . 1 . 1 23 23 DT H3' H 1 4.611 0.001 . 1 . . 633 . A 23 DT H3' . 34880 1 182 . 1 . 1 23 23 DT H6 H 1 7.225 0.002 . 1 . . 505 . A 23 DT H6 . 34880 1 183 . 1 . 1 23 23 DT H71 H 1 1.599 0.004 . 1 . . 506 . A 23 DT H71 . 34880 1 184 . 1 . 1 23 23 DT H72 H 1 1.599 0.004 . 1 . . 506 . A 23 DT H72 . 34880 1 185 . 1 . 1 23 23 DT H73 H 1 1.599 0.004 . 1 . . 506 . A 23 DT H73 . 34880 1 186 . 1 . 1 23 23 DT C6 C 13 138.633 . . 1 . . 685 . A 23 DT C6 . 34880 1 187 . 1 . 1 24 24 DA H1' H 1 5.854 0.003 . 1 . . 482 . A 24 DA H1' . 34880 1 188 . 1 . 1 24 24 DA H2 H 1 7.689 0.002 . 1 . . 658 . A 24 DA H2 . 34880 1 189 . 1 . 1 24 24 DA H2' H 1 2.689 0.004 . 1 . . 566 . A 24 DA H2' . 34880 1 190 . 1 . 1 24 24 DA H2'' H 1 2.694 0.004 . 1 . . 619 . A 24 DA H2'' . 34880 1 191 . 1 . 1 24 24 DA H3' H 1 4.926 . . 1 . . 635 . A 24 DA H3' . 34880 1 192 . 1 . 1 24 24 DA H8 H 1 7.887 0.001 . 1 . . 448 . A 24 DA H8 . 34880 1 193 . 1 . 1 24 24 DA C2 C 13 155.410 . . 1 . . 657 . A 24 DA C2 . 34880 1 194 . 1 . 1 24 24 DA C8 C 13 141.182 . . 1 . . 595 . A 24 DA C8 . 34880 1 195 . 1 . 1 25 25 DG H1 H 1 11.017 0.003 . 1 . . 671 . A 25 DG H1 . 34880 1 196 . 1 . 1 25 25 DG H1' H 1 6.078 0.002 . 1 . . 521 . A 25 DG H1' . 34880 1 197 . 1 . 1 25 25 DG H2' H 1 3.429 0.002 . 1 . . 552 . A 25 DG H2' . 34880 1 198 . 1 . 1 25 25 DG H2'' H 1 3.001 0.002 . 1 . . 551 . A 25 DG H2'' . 34880 1 199 . 1 . 1 25 25 DG H3' H 1 4.912 0.001 . 1 . . 632 . A 25 DG H3' . 34880 1 200 . 1 . 1 25 25 DG H8 H 1 7.492 0.002 . 1 . . 522 . A 25 DG H8 . 34880 1 201 . 1 . 1 25 25 DG C5 C 13 118.662 . . 1 . . 684 . A 25 DG C5 . 34880 1 202 . 1 . 1 25 25 DG C8 C 13 142.482 . . 1 . . 600 . A 25 DG C8 . 34880 1 203 . 1 . 1 26 26 DG H1 H 1 11.395 0.004 . 1 . . 667 . A 26 DG H1 . 34880 1 204 . 1 . 1 26 26 DG H1' H 1 6.035 0.004 . 1 . . 519 . A 26 DG H1' . 34880 1 205 . 1 . 1 26 26 DG H2' H 1 2.507 0.005 . 1 . . 590 . A 26 DG H2' . 34880 1 206 . 1 . 1 26 26 DG H2'' H 1 2.919 0.003 . 1 . . 587 . A 26 DG H2'' . 34880 1 207 . 1 . 1 26 26 DG H3' H 1 5.002 0.003 . 1 . . 631 . A 26 DG H3' . 34880 1 208 . 1 . 1 26 26 DG H8 H 1 7.822 0.002 . 1 . . 520 . A 26 DG H8 . 34880 1 209 . 1 . 1 26 26 DG C5 C 13 116.620 0.001 . 1 . . 677 . A 26 DG C5 . 34880 1 210 . 1 . 1 26 26 DG C8 C 13 138.247 . . 1 . . 694 . A 26 DG C8 . 34880 1 211 . 1 . 1 27 27 DG H1 H 1 11.017 0.003 . 1 . . 666 . A 27 DG H1 . 34880 1 212 . 1 . 1 27 27 DG H1' H 1 6.487 0.002 . 1 . . 512 . A 27 DG H1' . 34880 1 213 . 1 . 1 27 27 DG H2' H 1 2.669 0.002 . 1 . . 532 . A 27 DG H2' . 34880 1 214 . 1 . 1 27 27 DG H2'' H 1 2.671 0.001 . 1 . . 533 . A 27 DG H2'' . 34880 1 215 . 1 . 1 27 27 DG H3' H 1 5.130 0.002 . 1 . . 527 . A 27 DG H3' . 34880 1 216 . 1 . 1 27 27 DG H4' H 1 4.707 0.001 . 1 . . 529 . A 27 DG H4' . 34880 1 217 . 1 . 1 27 27 DG H8 H 1 7.700 0.002 . 1 . . 511 . A 27 DG H8 . 34880 1 218 . 1 . 1 27 27 DG C8 C 13 138.849 . . 1 . . 686 . A 27 DG C8 . 34880 1 219 . 1 . 1 28 28 DT H1' H 1 6.521 0.002 . 1 . . 625 . A 28 DT H1' . 34880 1 220 . 1 . 1 28 28 DT H2' H 1 2.428 0.002 . 1 . . 534 . A 28 DT H2' . 34880 1 221 . 1 . 1 28 28 DT H2'' H 1 2.756 0.001 . 1 . . 535 . A 28 DT H2'' . 34880 1 222 . 1 . 1 28 28 DT H3' H 1 5.132 0.002 . 1 . . 526 . A 28 DT H3' . 34880 1 223 . 1 . 1 28 28 DT H4' H 1 4.787 0.001 . 1 . . 528 . A 28 DT H4' . 34880 1 224 . 1 . 1 28 28 DT H6 H 1 7.887 0.002 . 1 . . 508 . A 28 DT H6 . 34880 1 225 . 1 . 1 28 28 DT H71 H 1 1.994 0.001 . 1 . . 510 . A 28 DT H71 . 34880 1 226 . 1 . 1 28 28 DT H72 H 1 1.994 0.001 . 1 . . 510 . A 28 DT H72 . 34880 1 227 . 1 . 1 28 28 DT H73 H 1 1.994 0.001 . 1 . . 510 . A 28 DT H73 . 34880 1 228 . 1 . 1 28 28 DT C6 C 13 139.920 . . 1 . . 597 . A 28 DT C6 . 34880 1 229 . 1 . 1 29 29 DG H1 H 1 11.730 0.002 . 1 . . 613 . A 29 DG H1 . 34880 1 230 . 1 . 1 29 29 DG H1' H 1 6.052 0.001 . 1 . . 454 . A 29 DG H1' . 34880 1 231 . 1 . 1 29 29 DG H2' H 1 2.963 0.004 . 1 . . 549 . A 29 DG H2' . 34880 1 232 . 1 . 1 29 29 DG H2'' H 1 3.077 0.002 . 1 . . 550 . A 29 DG H2'' . 34880 1 233 . 1 . 1 29 29 DG H3' H 1 5.119 0.001 . 1 . . 629 . A 29 DG H3' . 34880 1 234 . 1 . 1 29 29 DG H8 H 1 7.430 0.002 . 1 . . 523 . A 29 DG H8 . 34880 1 235 . 1 . 1 29 29 DG C5 C 13 119.107 0.024 . 1 . . 676 . A 29 DG C5 . 34880 1 236 . 1 . 1 29 29 DG C8 C 13 141.818 . . 1 . . 609 . A 29 DG C8 . 34880 1 237 . 1 . 1 30 30 DG H1 H 1 11.685 0.003 . 1 . . 617 . A 30 DG H1 . 34880 1 238 . 1 . 1 30 30 DG H1' H 1 5.946 0.003 . 1 . . 453 . A 30 DG H1' . 34880 1 239 . 1 . 1 30 30 DG H2' H 1 2.669 0.002 . 1 . . 547 . A 30 DG H2' . 34880 1 240 . 1 . 1 30 30 DG H2'' H 1 2.754 0.002 . 1 . . 548 . A 30 DG H2'' . 34880 1 241 . 1 . 1 30 30 DG H3' H 1 5.117 0.002 . 1 . . 628 . A 30 DG H3' . 34880 1 242 . 1 . 1 30 30 DG H8 H 1 8.167 0.002 . 1 . . 452 . A 30 DG H8 . 34880 1 243 . 1 . 1 30 30 DG C5 C 13 116.728 0.001 . 1 . . 618 . A 30 DG C5 . 34880 1 244 . 1 . 1 30 30 DG C8 C 13 139.492 . . 1 . . 591 . A 30 DG C8 . 34880 1 245 . 1 . 1 31 31 DG H1 H 1 11.421 0.003 . 1 . . 616 . A 31 DG H1 . 34880 1 246 . 1 . 1 31 31 DG H1' H 1 6.418 0.002 . 1 . . 514 . A 31 DG H1' . 34880 1 247 . 1 . 1 31 31 DG H2' H 1 2.559 0.004 . 1 . . 537 . A 31 DG H2' . 34880 1 248 . 1 . 1 31 31 DG H2'' H 1 2.483 0.001 . 1 . . 536 . A 31 DG H2'' . 34880 1 249 . 1 . 1 31 31 DG H3' H 1 4.698 0.001 . 1 . . 630 . A 31 DG H3' . 34880 1 250 . 1 . 1 31 31 DG H8 H 1 7.820 0.001 . 1 . . 513 . A 31 DG H8 . 34880 1 251 . 1 . 1 31 31 DG C5 C 13 117.213 0.0 . 1 . . 614 . A 31 DG C5 . 34880 1 252 . 1 . 1 31 31 DG C8 C 13 138.252 . . 1 . . 693 . A 31 DG C8 . 34880 1 stop_ save_