data_50989 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 50989 _Entry.Title ; Proton NMR chemical shifts of GGCCTG4 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-06-20 _Entry.Accession_date 2021-06-20 _Entry.Last_release_date 2021-06-20 _Entry.Original_release_date 2021-06-20 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Pei Guo . . . 0000-0001-7760-5786 50989 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 50989 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 158 50989 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-03-11 . original BMRB . 50989 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 50986 'Proton NMR chemical shifts of GGCCTG2' 50989 BMRB 50987 'Proton NMR chemical shifts of GGCCTG3' 50989 BMRB 50988 'Proton NMR chemical shifts of GGCCTG3-T2' 50989 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 50989 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 35077744 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; NMR solution structures of d(GGCCTG) n repeats associated with spinocerebellar ataxia type 36 ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Int. J. Biol. Macromol.' _Citation.Journal_name_full 'International journal of biological macromolecules' _Citation.Journal_volume 201 _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN 1879-0003 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 607 _Citation.Page_last 615 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Jie Yi J. . . . 50989 1 2 Liqi Wan L. . . . 50989 1 3 Yuan Liu Y. . . . 50989 1 4 'Sik Lok' Lam S. L. . . 50989 1 5 'Ho Yin Edwin' Chan . . . . 50989 1 6 Da Han D. . . . 50989 1 7 Pei Guo P. . . . 50989 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 50989 _Assembly.ID 1 _Assembly.Name GGCCTG4 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 GGCCTG4 1 $entity_1 . . yes native no no . . . 50989 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 50989 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCCTGGGCCTGGGCCTGGG CCTG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 24 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . DG . 50989 1 2 . DG . 50989 1 3 . DC . 50989 1 4 . DC . 50989 1 5 . DT . 50989 1 6 . DG . 50989 1 7 . DG . 50989 1 8 . DG . 50989 1 9 . DC . 50989 1 10 . DC . 50989 1 11 . DT . 50989 1 12 . DG . 50989 1 13 . DG . 50989 1 14 . DG . 50989 1 15 . DC . 50989 1 16 . DC . 50989 1 17 . DT . 50989 1 18 . DG . 50989 1 19 . DG . 50989 1 20 . DG . 50989 1 21 . DC . 50989 1 22 . DC . 50989 1 23 . DT . 50989 1 24 . DG . 50989 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 50989 1 . DG 2 2 50989 1 . DC 3 3 50989 1 . DC 4 4 50989 1 . DT 5 5 50989 1 . DG 6 6 50989 1 . DG 7 7 50989 1 . DG 8 8 50989 1 . DC 9 9 50989 1 . DC 10 10 50989 1 . DT 11 11 50989 1 . DG 12 12 50989 1 . DG 13 13 50989 1 . DG 14 14 50989 1 . DC 15 15 50989 1 . DC 16 16 50989 1 . DT 17 17 50989 1 . DG 18 18 50989 1 . DG 19 19 50989 1 . DG 20 20 50989 1 . DC 21 21 50989 1 . DC 22 22 50989 1 . DT 23 23 50989 1 . DG 24 24 50989 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 50989 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 50989 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 50989 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 50989 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 50989 _Sample.ID 1 _Sample.Name GGCCTG4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 GGCCTG4 'natural abundance' . . 1 $entity_1 . . 0.3 . . mM . . . . 50989 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 50989 _Sample_condition_list.ID 1 _Sample_condition_list.Name GGCCTG4 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 1 . mM 50989 1 pH 7 . pH 50989 1 pressure 1 . atm 50989 1 temperature 303 . K 50989 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 50989 _Software.ID 1 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 50989 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 50989 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker Avance 600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model Avance _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 50989 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50989 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 50989 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name DSS _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1 . . . . . 50989 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 50989 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name GGCCTG4 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 50989 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 50989 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DG H1 H 1 13.06 0.01 . 1 . . . . . 1 G H1 . 50989 1 2 . 1 . 1 1 1 DG H1' H 1 5.80 0.01 . 1 . . . . . 1 G H1' . 50989 1 3 . 1 . 1 1 1 DG H2' H 1 2.58 0.01 . 1 . . . . . 1 G H2' . 50989 1 4 . 1 . 1 1 1 DG H2'' H 1 2.77 0.01 . 1 . . . . . 1 G H2'' . 50989 1 5 . 1 . 1 1 1 DG H8 H 1 7.88 0.01 . 1 . . . . . 1 G H8 . 50989 1 6 . 1 . 1 2 2 DG H1 H 1 13.07 0.01 . 1 . . . . . 2 G H1 . 50989 1 7 . 1 . 1 2 2 DG H1' H 1 5.97 0.01 . 1 . . . . . 2 G H1' . 50989 1 8 . 1 . 1 2 2 DG H2' H 1 2.63 0.01 . 1 . . . . . 2 G H2' . 50989 1 9 . 1 . 1 2 2 DG H2'' H 1 2.74 0.01 . 1 . . . . . 2 G H2'' . 50989 1 10 . 1 . 1 2 2 DG H3' H 1 4.98 0.01 . 1 . . . . . 2 G H3' . 50989 1 11 . 1 . 1 2 2 DG H8 H 1 7.81 0.01 . 1 . . . . . 2 G H8 . 50989 1 12 . 1 . 1 3 3 DC H1' H 1 6.03 0.01 . 1 . . . . . 3 C H1' . 50989 1 13 . 1 . 1 3 3 DC H2' H 1 2.14 0.01 . 1 . . . . . 3 C H2' . 50989 1 14 . 1 . 1 3 3 DC H2'' H 1 2.49 0.01 . 1 . . . . . 3 C H2'' . 50989 1 15 . 1 . 1 3 3 DC H3' H 1 4.79 0.01 . 1 . . . . . 3 C H3' . 50989 1 16 . 1 . 1 3 3 DC H5 H 1 5.31 0.01 . 1 . . . . . 3 C H5 . 50989 1 17 . 1 . 1 3 3 DC H6 H 1 7.39 0.01 . 1 . . . . . 3 C H6 . 50989 1 18 . 1 . 1 3 3 DC H41 H 1 8.19 0.01 . 1 . . . . . 3 C H41 . 50989 1 19 . 1 . 1 3 3 DC H42 H 1 6.48 0.01 . 1 . . . . . 3 C H42 . 50989 1 20 . 1 . 1 4 4 DC H1' H 1 6.03 0.01 . 1 . . . . . 4 C H1' . 50989 1 21 . 1 . 1 4 4 DC H2' H 1 2.09 0.01 . 1 . . . . . 4 C H2' . 50989 1 22 . 1 . 1 4 4 DC H2'' H 1 2.50 0.01 . 1 . . . . . 4 C H2'' . 50989 1 23 . 1 . 1 4 4 DC H3' H 1 4.79 0.01 . 1 . . . . . 4 C H3' . 50989 1 24 . 1 . 1 4 4 DC H5 H 1 5.51 0.01 . 1 . . . . . 4 C H5 . 50989 1 25 . 1 . 1 4 4 DC H6 H 1 7.45 0.01 . 1 . . . . . 4 C H6 . 50989 1 26 . 1 . 1 4 4 DC H41 H 1 8.47 0.01 . 1 . . . . . 4 C H41 . 50989 1 27 . 1 . 1 4 4 DC H42 H 1 6.88 0.01 . 1 . . . . . 4 C H42 . 50989 1 28 . 1 . 1 5 5 DT H1' H 1 5.67 0.01 . 1 . . . . . 5 T H1' . 50989 1 29 . 1 . 1 5 5 DT H2' H 1 2.24 0.01 . 1 . . . . . 5 T H2' . 50989 1 30 . 1 . 1 5 5 DT H2'' H 1 2.36 0.01 . 1 . . . . . 5 T H2'' . 50989 1 31 . 1 . 1 5 5 DT H3 H 1 11.80 0.01 . 1 . . . . . 5 T H3 . 50989 1 32 . 1 . 1 5 5 DT H6 H 1 7.45 0.01 . 1 . . . . . 5 T H6 . 50989 1 33 . 1 . 1 5 5 DT H71 H 1 1.76 0.01 . 1 . . . . . 5 T H71 . 50989 1 34 . 1 . 1 5 5 DT H72 H 1 1.76 0.01 . 1 . . . . . 5 T H72 . 50989 1 35 . 1 . 1 5 5 DT H73 H 1 1.76 0.01 . 1 . . . . . 5 T H73 . 50989 1 36 . 1 . 1 6 6 DG H1 H 1 10.86 0.01 . 1 . . . . . 6 G H1 . 50989 1 37 . 1 . 1 6 6 DG H1' H 1 5.73 0.01 . 1 . . . . . 6 G H1' . 50989 1 38 . 1 . 1 6 6 DG H2' H 1 2.56 0.01 . 1 . . . . . 6 G H2' . 50989 1 39 . 1 . 1 6 6 DG H2'' H 1 2.74 0.01 . 1 . . . . . 6 G H2'' . 50989 1 40 . 1 . 1 6 6 DG H8 H 1 7.82 0.01 . 1 . . . . . 6 G H8 . 50989 1 41 . 1 . 1 7 7 DG H1 H 1 13.08 0.01 . 1 . . . . . 7 G H1 . 50989 1 42 . 1 . 1 7 7 DG H1' H 1 5.65 0.01 . 1 . . . . . 7 G H1' . 50989 1 43 . 1 . 1 7 7 DG H2' H 1 2.58 0.01 . 1 . . . . . 7 G H2' . 50989 1 44 . 1 . 1 7 7 DG H2'' H 1 2.70 0.01 . 1 . . . . . 7 G H2'' . 50989 1 45 . 1 . 1 7 7 DG H3' H 1 4.96 0.01 . 1 . . . . . 7 G H3' . 50989 1 46 . 1 . 1 7 7 DG H8 H 1 7.67 0.01 . 1 . . . . . 7 G H8 . 50989 1 47 . 1 . 1 8 8 DG H1 H 1 13.07 0.01 . 1 . . . . . 8 G H1 . 50989 1 48 . 1 . 1 8 8 DG H1' H 1 5.91 0.01 . 1 . . . . . 8 G H1' . 50989 1 49 . 1 . 1 8 8 DG H2' H 1 2.48 0.01 . 1 . . . . . 8 G H2' . 50989 1 50 . 1 . 1 8 8 DG H2'' H 1 2.68 0.01 . 1 . . . . . 8 G H2'' . 50989 1 51 . 1 . 1 8 8 DG H3' H 1 4.94 0.01 . 1 . . . . . 8 G H3' . 50989 1 52 . 1 . 1 8 8 DG H8 H 1 7.66 0.01 . 1 . . . . . 8 G H8 . 50989 1 53 . 1 . 1 9 9 DC H1' H 1 5.98 0.01 . 1 . . . . . 9 C H1' . 50989 1 54 . 1 . 1 9 9 DC H2' H 1 1.91 0.01 . 1 . . . . . 9 C H2' . 50989 1 55 . 1 . 1 9 9 DC H2'' H 1 2.37 0.01 . 1 . . . . . 9 C H2'' . 50989 1 56 . 1 . 1 9 9 DC H3' H 1 4.76 0.01 . 1 . . . . . 9 C H3' . 50989 1 57 . 1 . 1 9 9 DC H5 H 1 5.34 0.01 . 1 . . . . . 9 C H5 . 50989 1 58 . 1 . 1 9 9 DC H6 H 1 7.24 0.01 . 1 . . . . . 9 C H6 . 50989 1 59 . 1 . 1 9 9 DC H41 H 1 8.41 0.01 . 1 . . . . . 9 C H41 . 50989 1 60 . 1 . 1 9 9 DC H42 H 1 6.56 0.01 . 1 . . . . . 9 C H42 . 50989 1 61 . 1 . 1 10 10 DC H1' H 1 6.11 0.01 . 1 . . . . . 10 C H1' . 50989 1 62 . 1 . 1 10 10 DC H2' H 1 2.21 0.01 . 1 . . . . . 10 C H2' . 50989 1 63 . 1 . 1 10 10 DC H2'' H 1 2.48 0.01 . 1 . . . . . 10 C H2'' . 50989 1 64 . 1 . 1 10 10 DC H5 H 1 5.66 0.01 . 1 . . . . . 10 C H5 . 50989 1 65 . 1 . 1 10 10 DC H6 H 1 7.64 0.01 . 1 . . . . . 10 C H6 . 50989 1 66 . 1 . 1 11 11 DT H1' H 1 5.80 0.01 . 1 . . . . . 11 T H1' . 50989 1 67 . 1 . 1 11 11 DT H2' H 1 1.37 0.01 . 1 . . . . . 11 T H2' . 50989 1 68 . 1 . 1 11 11 DT H2'' H 1 1.96 0.01 . 1 . . . . . 11 T H2'' . 50989 1 69 . 1 . 1 11 11 DT H3' H 1 4.56 0.01 . 1 . . . . . 11 T H3' . 50989 1 70 . 1 . 1 11 11 DT H6 H 1 7.33 0.01 . 1 . . . . . 11 T H6 . 50989 1 71 . 1 . 1 11 11 DT H71 H 1 1.80 0.01 . 1 . . . . . 11 T H71 . 50989 1 72 . 1 . 1 11 11 DT H72 H 1 1.80 0.01 . 1 . . . . . 11 T H72 . 50989 1 73 . 1 . 1 11 11 DT H73 H 1 1.80 0.01 . 1 . . . . . 11 T H73 . 50989 1 74 . 1 . 1 12 12 DG H1' H 1 5.71 0.01 . 1 . . . . . 12 G H1' . 50989 1 75 . 1 . 1 12 12 DG H2' H 1 2.43 0.01 . 1 . . . . . 12 G H2' . 50989 1 76 . 1 . 1 12 12 DG H2'' H 1 2.26 0.01 . 1 . . . . . 12 G H2'' . 50989 1 77 . 1 . 1 12 12 DG H3' H 1 4.68 0.01 . 1 . . . . . 12 G H3' . 50989 1 78 . 1 . 1 12 12 DG H8 H 1 7.76 0.01 . 1 . . . . . 12 G H8 . 50989 1 79 . 1 . 1 13 13 DG H1' H 1 5.66 0.01 . 1 . . . . . 13 G H1' . 50989 1 80 . 1 . 1 13 13 DG H2' H 1 2.58 0.01 . 1 . . . . . 13 G H2' . 50989 1 81 . 1 . 1 13 13 DG H2'' H 1 2.78 0.01 . 1 . . . . . 13 G H2'' . 50989 1 82 . 1 . 1 13 13 DG H3' H 1 4.84 0.01 . 1 . . . . . 13 G H3' . 50989 1 83 . 1 . 1 13 13 DG H8 H 1 7.84 0.01 . 1 . . . . . 13 G H8 . 50989 1 84 . 1 . 1 14 14 DG H1 H 1 13.02 0.01 . 1 . . . . . 14 G H1 . 50989 1 85 . 1 . 1 14 14 DG H1' H 1 5.86 0.01 . 1 . . . . . 14 G H1' . 50989 1 86 . 1 . 1 14 14 DG H2' H 1 2.66 0.01 . 1 . . . . . 14 G H2' . 50989 1 87 . 1 . 1 14 14 DG H2'' H 1 2.66 0.01 . 1 . . . . . 14 G H2'' . 50989 1 88 . 1 . 1 14 14 DG H8 H 1 7.79 0.01 . 1 . . . . . 14 G H8 . 50989 1 89 . 1 . 1 15 15 DC H1' H 1 6.05 0.01 . 1 . . . . . 15 C H1' . 50989 1 90 . 1 . 1 15 15 DC H2' H 1 2.18 0.01 . 1 . . . . . 15 C H2' . 50989 1 91 . 1 . 1 15 15 DC H2'' H 1 2.50 0.01 . 1 . . . . . 15 C H2'' . 50989 1 92 . 1 . 1 15 15 DC H3' H 1 4.79 0.01 . 1 . . . . . 15 C H3' . 50989 1 93 . 1 . 1 15 15 DC H5 H 1 5.32 0.01 . 1 . . . . . 15 C H5 . 50989 1 94 . 1 . 1 15 15 DC H6 H 1 7.43 0.01 . 1 . . . . . 15 C H6 . 50989 1 95 . 1 . 1 15 15 DC H41 H 1 8.36 0.01 . 1 . . . . . 15 C H41 . 50989 1 96 . 1 . 1 15 15 DC H42 H 1 6.54 0.01 . 1 . . . . . 15 C H42 . 50989 1 97 . 1 . 1 16 16 DC H1' H 1 6.03 0.01 . 1 . . . . . 16 C H1' . 50989 1 98 . 1 . 1 16 16 DC H2' H 1 2.10 0.01 . 1 . . . . . 16 C H2' . 50989 1 99 . 1 . 1 16 16 DC H2'' H 1 2.50 0.01 . 1 . . . . . 16 C H2'' . 50989 1 100 . 1 . 1 16 16 DC H3' H 1 4.79 0.01 . 1 . . . . . 16 C H3' . 50989 1 101 . 1 . 1 16 16 DC H5 H 1 5.52 0.01 . 1 . . . . . 16 C H5 . 50989 1 102 . 1 . 1 16 16 DC H6 H 1 7.47 0.01 . 1 . . . . . 16 C H6 . 50989 1 103 . 1 . 1 16 16 DC H41 H 1 8.47 0.01 . 1 . . . . . 16 C H41 . 50989 1 104 . 1 . 1 16 16 DC H42 H 1 6.88 0.01 . 1 . . . . . 16 C H42 . 50989 1 105 . 1 . 1 17 17 DT H1' H 1 5.68 0.01 . 1 . . . . . 17 T H1' . 50989 1 106 . 1 . 1 17 17 DT H2' H 1 2.24 0.01 . 1 . . . . . 17 T H2' . 50989 1 107 . 1 . 1 17 17 DT H2'' H 1 2.36 0.01 . 1 . . . . . 17 T H2'' . 50989 1 108 . 1 . 1 17 17 DT H3 H 1 11.80 0.01 . 1 . . . . . 17 T H3 . 50989 1 109 . 1 . 1 17 17 DT H6 H 1 7.45 0.01 . 1 . . . . . 17 T H6 . 50989 1 110 . 1 . 1 17 17 DT H71 H 1 1.76 0.01 . 1 . . . . . 17 T H71 . 50989 1 111 . 1 . 1 17 17 DT H72 H 1 1.76 0.01 . 1 . . . . . 17 T H72 . 50989 1 112 . 1 . 1 17 17 DT H73 H 1 1.76 0.01 . 1 . . . . . 17 T H73 . 50989 1 113 . 1 . 1 18 18 DG H1 H 1 10.86 0.01 . 1 . . . . . 18 G H1 . 50989 1 114 . 1 . 1 18 18 DG H1' H 1 5.73 0.01 . 1 . . . . . 18 G H1' . 50989 1 115 . 1 . 1 18 18 DG H2' H 1 2.55 0.01 . 1 . . . . . 18 G H2' . 50989 1 116 . 1 . 1 18 18 DG H2'' H 1 2.73 0.01 . 1 . . . . . 18 G H2'' . 50989 1 117 . 1 . 1 18 18 DG H8 H 1 7.83 0.01 . 1 . . . . . 18 G H8 . 50989 1 118 . 1 . 1 19 19 DG H1 H 1 13.08 0.01 . 1 . . . . . 19 G H1 . 50989 1 119 . 1 . 1 19 19 DG H1' H 1 5.64 0.01 . 1 . . . . . 19 G H1' . 50989 1 120 . 1 . 1 19 19 DG H2' H 1 2.59 0.01 . 1 . . . . . 19 G H2' . 50989 1 121 . 1 . 1 19 19 DG H2'' H 1 2.69 0.01 . 1 . . . . . 19 G H2'' . 50989 1 122 . 1 . 1 19 19 DG H3' H 1 4.96 0.01 . 1 . . . . . 19 G H3' . 50989 1 123 . 1 . 1 19 19 DG H8 H 1 7.67 0.01 . 1 . . . . . 19 G H8 . 50989 1 124 . 1 . 1 20 20 DG H1 H 1 13.07 0.01 . 1 . . . . . 20 G H1 . 50989 1 125 . 1 . 1 20 20 DG H1' H 1 5.90 0.01 . 1 . . . . . 20 G H1' . 50989 1 126 . 1 . 1 20 20 DG H2' H 1 2.57 0.01 . 1 . . . . . 20 G H2' . 50989 1 127 . 1 . 1 20 20 DG H2'' H 1 2.70 0.01 . 1 . . . . . 20 G H2'' . 50989 1 128 . 1 . 1 20 20 DG H3' H 1 4.94 0.01 . 1 . . . . . 20 G H3' . 50989 1 129 . 1 . 1 20 20 DG H8 H 1 7.69 0.01 . 1 . . . . . 20 G H8 . 50989 1 130 . 1 . 1 21 21 DC H1' H 1 5.96 0.01 . 1 . . . . . 21 C H1' . 50989 1 131 . 1 . 1 21 21 DC H2' H 1 2.09 0.01 . 1 . . . . . 21 C H2' . 50989 1 132 . 1 . 1 21 21 DC H2'' H 1 2.44 0.01 . 1 . . . . . 21 C H2'' . 50989 1 133 . 1 . 1 21 21 DC H3' H 1 4.76 0.01 . 1 . . . . . 21 C H3' . 50989 1 134 . 1 . 1 21 21 DC H5 H 1 5.32 0.01 . 1 . . . . . 21 C H5 . 50989 1 135 . 1 . 1 21 21 DC H6 H 1 7.36 0.01 . 1 . . . . . 21 C H6 . 50989 1 136 . 1 . 1 21 21 DC H41 H 1 8.36 0.01 . 1 . . . . . 21 C H41 . 50989 1 137 . 1 . 1 21 21 DC H42 H 1 6.54 0.01 . 1 . . . . . 21 C H42 . 50989 1 138 . 1 . 1 22 22 DC H1' H 1 6.12 0.01 . 1 . . . . . 22 C H1' . 50989 1 139 . 1 . 1 22 22 DC H2' H 1 2.25 0.01 . 1 . . . . . 22 C H2' . 50989 1 140 . 1 . 1 22 22 DC H2'' H 1 2.43 0.01 . 1 . . . . . 22 C H2'' . 50989 1 141 . 1 . 1 22 22 DC H3' H 1 4.82 0.01 . 1 . . . . . 22 C H3' . 50989 1 142 . 1 . 1 22 22 DC H5 H 1 5.63 0.01 . 1 . . . . . 22 C H5 . 50989 1 143 . 1 . 1 22 22 DC H6 H 1 7.58 0.01 . 1 . . . . . 22 C H6 . 50989 1 144 . 1 . 1 22 22 DC H41 H 1 8.50 0.01 . 1 . . . . . 22 C H41 . 50989 1 145 . 1 . 1 22 22 DC H42 H 1 7.09 0.01 . 1 . . . . . 22 C H42 . 50989 1 146 . 1 . 1 23 23 DT H1' H 1 6.10 0.01 . 1 . . . . . 23 T H1' . 50989 1 147 . 1 . 1 23 23 DT H2' H 1 2.01 0.01 . 1 . . . . . 23 T H2' . 50989 1 148 . 1 . 1 23 23 DT H2'' H 1 2.32 0.01 . 1 . . . . . 23 T H2'' . 50989 1 149 . 1 . 1 23 23 DT H3' H 1 4.72 0.01 . 1 . . . . . 23 T H3' . 50989 1 150 . 1 . 1 23 23 DT H6 H 1 7.49 0.01 . 1 . . . . . 23 T H6 . 50989 1 151 . 1 . 1 23 23 DT H71 H 1 1.78 0.01 . 1 . . . . . 23 T H71 . 50989 1 152 . 1 . 1 23 23 DT H72 H 1 1.78 0.01 . 1 . . . . . 23 T H72 . 50989 1 153 . 1 . 1 23 23 DT H73 H 1 1.78 0.01 . 1 . . . . . 23 T H73 . 50989 1 154 . 1 . 1 24 24 DG H1' H 1 6.05 0.01 . 1 . . . . . 24 G H1' . 50989 1 155 . 1 . 1 24 24 DG H2' H 1 2.60 0.01 . 1 . . . . . 24 G H2' . 50989 1 156 . 1 . 1 24 24 DG H2'' H 1 2.35 0.01 . 1 . . . . . 24 G H2'' . 50989 1 157 . 1 . 1 24 24 DG H3' H 1 4.54 0.01 . 1 . . . . . 24 G H3' . 50989 1 158 . 1 . 1 24 24 DG H8 H 1 7.84 0.01 . 1 . . . . . 24 G H8 . 50989 1 stop_ save_