data_51037 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 51037 _Entry.Title ; loxP spacer 22-mer ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-07-28 _Entry.Accession_date 2021-07-28 _Entry.Last_release_date 2021-07-28 _Entry.Original_release_date 2021-07-28 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Nicole Wagner . . . . 51037 2 Mark Foster . . . . 51037 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 51037 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 33 51037 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2022-01-22 . original BMRB . 51037 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 51032 'loxP spacer 10-mer' 51037 BMRB 51035 'loxP spacer 12-mer' 51037 BMRB 51036 'loxP spacer 16-mer' 51037 BMRB 51047 'lox4 spacer 16-mer' 51037 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 51037 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 34985267 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Nearest-neighbor effects modulate loxP spacer DNA chemical shifts and guide oligonucleotide design for nuclear magnetic resonance studies ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev Biochemistry _Citation.Journal_name_full Biochemistry _Citation.Journal_volume 61 _Citation.Journal_issue 2 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 67 _Citation.Page_last 76 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Nicole Wagner . . . . 51037 1 2 Mark Foster . . . . 51037 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 51037 _Assembly.ID 1 _Assembly.Name 'loxP spacer 22-mer' _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 A 1 $entity_1 . . yes native no no . . . 51037 1 2 B 2 $entity_2 . . yes native no no . . . 51037 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 51037 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GCGTATAATGTATGCTATAC GG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DG . 51037 1 2 2 DC . 51037 1 3 3 DG . 51037 1 4 4 DT . 51037 1 5 5 DA . 51037 1 6 6 DT . 51037 1 7 7 DA . 51037 1 8 8 DA . 51037 1 9 9 DT . 51037 1 10 10 DG . 51037 1 11 11 DT . 51037 1 12 12 DA . 51037 1 13 13 DT . 51037 1 14 14 DG . 51037 1 15 15 DC . 51037 1 16 16 DT . 51037 1 17 17 DA . 51037 1 18 18 DT . 51037 1 19 19 DA . 51037 1 20 20 DC . 51037 1 21 21 DG . 51037 1 22 22 DG . 51037 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DG 1 1 51037 1 . DC 2 2 51037 1 . DG 3 3 51037 1 . DT 4 4 51037 1 . DA 5 5 51037 1 . DT 6 6 51037 1 . DA 7 7 51037 1 . DA 8 8 51037 1 . DT 9 9 51037 1 . DG 10 10 51037 1 . DT 11 11 51037 1 . DA 12 12 51037 1 . DT 13 13 51037 1 . DG 14 14 51037 1 . DC 15 15 51037 1 . DT 16 16 51037 1 . DA 17 17 51037 1 . DT 18 18 51037 1 . DA 19 19 51037 1 . DC 20 20 51037 1 . DG 21 21 51037 1 . DG 22 22 51037 1 stop_ save_ save_entity_2 _Entity.Sf_category entity _Entity.Sf_framecode entity_2 _Entity.Entry_ID 51037 _Entity.ID 2 _Entity.BMRB_code . _Entity.Name entity_2 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; CCGTATAGCATACATTATAC GC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DC . 51037 2 2 2 DC . 51037 2 3 3 DG . 51037 2 4 4 DT . 51037 2 5 5 DA . 51037 2 6 6 DT . 51037 2 7 7 DA . 51037 2 8 8 DG . 51037 2 9 9 DC . 51037 2 10 10 DA . 51037 2 11 11 DT . 51037 2 12 12 DA . 51037 2 13 13 DC . 51037 2 14 14 DA . 51037 2 15 15 DT . 51037 2 16 16 DT . 51037 2 17 17 DA . 51037 2 18 18 DT . 51037 2 19 19 DA . 51037 2 20 20 DC . 51037 2 21 21 DG . 51037 2 22 22 DC . 51037 2 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DC 1 1 51037 2 . DC 2 2 51037 2 . DG 3 3 51037 2 . DT 4 4 51037 2 . DA 5 5 51037 2 . DT 6 6 51037 2 . DA 7 7 51037 2 . DG 8 8 51037 2 . DC 9 9 51037 2 . DA 10 10 51037 2 . DT 11 11 51037 2 . DA 12 12 51037 2 . DC 13 13 51037 2 . DA 14 14 51037 2 . DT 15 15 51037 2 . DT 16 16 51037 2 . DA 17 17 51037 2 . DT 18 18 51037 2 . DA 19 19 51037 2 . DC 20 20 51037 2 . DG 21 21 51037 2 . DC 22 22 51037 2 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 51037 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . . organism . 'not available' . . . . . not available . . . . . . . . . . . . . 51037 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 51037 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'obtained from a vendor' . . . . . . . . . . . . . . . . 51037 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 51037 _Sample.ID 1 _Sample.Name sample1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'loxP spacer 22-mer' 'natural abundance' . . 1 $entity_1 . . 590 . . uM . . . . 51037 1 2 'sodium chloride' 'natural abundance' . . . . . . 100 . . mM . . . . 51037 1 3 TRIS [U-2H] . . . . . . 10 . . mM . . . . 51037 1 4 DSS 'natural abundance' . . . . . . 50 . . uM . . . . 51037 1 5 'sodium azide' 'natural abundance' . . . . . . 0.02 . . % . . . . 51037 1 6 D2O 'natural abundance' . . . . . . 10 . . % . . . . 51037 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 51037 _Sample_condition_list.ID 1 _Sample_condition_list.Name sample_conditions1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.1 . M 51037 1 pH 7.0 . pH 51037 1 pressure 1 . atm 51037 1 temperature 298 . K 51037 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 51037 _Software.ID 1 _Software.Type . _Software.Name 'NMRFx Processor' _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 51037 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 51037 _Software.ID 2 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 51037 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 51037 _Software.ID 3 _Software.Type . _Software.Name NMRViewJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 51037 3 'data analysis' . 51037 3 'peak picking' . 51037 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 51037 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 600 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 51037 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name 850 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 850 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 51037 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '1D 1H' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51037 1 2 '2D 1H-1H TOCSY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51037 1 3 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51037 1 4 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 51037 1 5 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51037 1 6 '2D 1H-13C HSQC anomeric' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 51037 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 51037 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name loxP_22mer_shifts _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 internal direct 1 . . . . . 51037 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 51037 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name assigned_chem_shift_list_1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-1H TOCSY' . . . 51037 1 3 '2D 1H-1H NOESY' . . . 51037 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 51037 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 8 8 DA H1' H 1 6.0792 0.0 . 1 . . . . . 8 DA H1' . 51037 1 2 . 1 . 1 8 8 DA H8 H 1 8.0604 0.0 . 1 . . . . . 8 DA H8 . 51037 1 3 . 1 . 1 9 9 DT H1' H 1 5.6692 0.0 . 1 . . . . . 9 DT H1' . 51037 1 4 . 1 . 1 9 9 DT H6 H 1 6.9368 0.0 . 1 . . . . . 9 DT H6 . 51037 1 5 . 1 . 1 10 10 DG H1' H 1 5.8397 0.0 . 1 . . . . . 10 DG H1' . 51037 1 6 . 1 . 1 10 10 DG H8 H 1 7.6568 0.0 . 1 . . . . . 10 DG H8 . 51037 1 7 . 1 . 1 11 11 DT H1' H 1 5.6951 0.0 . 1 . . . . . 11 DT H1' . 51037 1 8 . 1 . 1 11 11 DT H6 H 1 7.1424 0.0 . 1 . . . . . 11 DT H6 . 51037 1 9 . 1 . 1 12 12 DA H1' H 1 6.1798 0.0 . 1 . . . . . 12 DA H1' . 51037 1 10 . 1 . 1 12 12 DA H8 H 1 8.2239 0.0 . 1 . . . . . 12 DA H8 . 51037 1 11 . 1 . 1 13 13 DT H1' H 1 5.6864 0.0 . 1 . . . . . 13 DT H1' . 51037 1 12 . 1 . 1 13 13 DT H6 H 1 7.0188 0.0 . 1 . . . . . 13 DT H6 . 51037 1 13 . 1 . 1 14 14 DG H1' H 1 5.7809 0.0 . 1 . . . . . 14 DG H1' . 51037 1 14 . 1 . 1 14 14 DG H8 H 1 7.7499 0.0 . 1 . . . . . 14 DG H8 . 51037 1 15 . 1 . 1 15 15 DC H1' H 1 5.814 0.0 . 1 . . . . . 15 DC H1' . 51037 1 16 . 1 . 1 15 15 DC H6 H 1 7.3111 0.0 . 1 . . . . . 15 DC H6 . 51037 1 17 . 2 . 2 7 7 DA H1' H 1 5.9613 0.0 . 1 . . . . . 7 DA H1' . 51037 1 18 . 2 . 2 8 8 DG H1' H 1 5.6455 0.0 . 1 . . . . . 8 DG H1' . 51037 1 19 . 2 . 2 8 8 DG H8 H 1 7.5523 0.0 . 1 . . . . . 8 DG H8 . 51037 1 20 . 2 . 2 9 9 DC H1' H 1 5.5356 0.0 . 1 . . . . . 9 DC H1' . 51037 1 21 . 2 . 2 9 9 DC H6 H 1 7.194 0.0 . 1 . . . . . 9 DC H6 . 51037 1 22 . 2 . 2 10 10 DA H1' H 1 6.152 0.0 . 1 . . . . . 10 DA H1' . 51037 1 23 . 2 . 2 10 10 DA H8 H 1 8.1795 0.0 . 1 . . . . . 10 DA H8 . 51037 1 24 . 2 . 2 11 11 DT H1' H 1 5.5618 0.0 . 1 . . . . . 11 DT H1' . 51037 1 25 . 2 . 2 11 11 DT H6 H 1 7.0695 0.0 . 1 . . . . . 11 DT H6 . 51037 1 26 . 2 . 2 12 12 DA H1' H 1 6.1046 0.0 . 1 . . . . . 12 DA H1' . 51037 1 27 . 2 . 2 12 12 DA H8 H 1 8.1444 0.0 . 1 . . . . . 12 DA H8 . 51037 1 28 . 2 . 2 13 13 DC H1' H 1 5.4746 0.0 . 1 . . . . . 13 DC H1' . 51037 1 29 . 2 . 2 13 13 DC H6 H 1 7.2057 0.0 . 1 . . . . . 13 DC H6 . 51037 1 30 . 2 . 2 14 14 DA H1' H 1 6.1602 0.0 . 1 . . . . . 14 DA H1' . 51037 1 31 . 2 . 2 14 14 DA H8 H 1 8.1368 0.0 . 1 . . . . . 14 DA H8 . 51037 1 32 . 2 . 2 15 15 DT H1' H 1 5.8755 0.0 . 1 . . . . . 15 DT H1' . 51037 1 33 . 2 . 2 15 15 DT H6 H 1 7.1242 0.0 . 1 . . . . . 15 DT H6 . 51037 1 stop_ save_