data_51310 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 51310 _Entry.Title ; Encoded Conformational Dynamics of the HIV Splice Site A3 Regulatory Locus: Implications for differential binding of hnRNP Splicing Auxiliary Factors ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2022-02-06 _Entry.Accession_date 2022-02-06 _Entry.Last_release_date 2022-02-15 _Entry.Original_release_date 2022-02-15 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Liang-Yuan Chiu . . . . 51310 2 Niyati Jain . . . . 51310 3 Andrew Sugarman . . . . 51310 4 Blanton Tolbert . . . . 51310 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 51310 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 137 51310 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2022-10-21 2022-02-06 update BMRB 'update entry citation' 51310 1 . . 2022-06-22 2022-02-06 original author 'original release' 51310 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 51310 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 35870649 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Encoded Conformational Dynamics of the HIV Splice Site A3 Regulatory Locus: Implications for Differential Binding of hnRNP Splicing Auxiliary Factors ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Mol. Biol.' _Citation.Journal_name_full 'Journal of molecular biology' _Citation.Journal_volume 434 _Citation.Journal_issue 18 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1089-8638 _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 167728 _Citation.Page_last 167728 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Liang-Yuan Chiu L. Y. . . 51310 1 2 Ann Emery A. . . . 51310 1 3 Niyati Jain N. . . . 51310 1 4 Andrew Sugarman A. . . . 51310 1 5 Nashea Kendrick N. . . . 51310 1 6 Le Luo L. . . . 51310 1 7 William Ford W. . . . 51310 1 8 Ronald Swanstrom R. . . . 51310 1 9 Blanton Tolbert B. S. . . 51310 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 51310 _Assembly.ID 1 _Assembly.Name entity_1 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 . . yes native no no . . . 51310 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 51310 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGUGCUGUUUAUCCAUUUCA GAAUUGGGUGUCGACAUAGC ACC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 43 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 51310 1 2 . G . 51310 1 3 . U . 51310 1 4 . G . 51310 1 5 . C . 51310 1 6 . U . 51310 1 7 . G . 51310 1 8 . U . 51310 1 9 . U . 51310 1 10 . U . 51310 1 11 . A . 51310 1 12 . U . 51310 1 13 . C . 51310 1 14 . C . 51310 1 15 . A . 51310 1 16 . U . 51310 1 17 . U . 51310 1 18 . U . 51310 1 19 . C . 51310 1 20 . A . 51310 1 21 . G . 51310 1 22 . A . 51310 1 23 . A . 51310 1 24 . U . 51310 1 25 . U . 51310 1 26 . G . 51310 1 27 . G . 51310 1 28 . G . 51310 1 29 . U . 51310 1 30 . G . 51310 1 31 . U . 51310 1 32 . C . 51310 1 33 . G . 51310 1 34 . A . 51310 1 35 . C . 51310 1 36 . A . 51310 1 37 . U . 51310 1 38 . A . 51310 1 39 . G . 51310 1 40 . C . 51310 1 41 . A . 51310 1 42 . C . 51310 1 43 . C . 51310 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 51310 1 . G 2 2 51310 1 . U 3 3 51310 1 . G 4 4 51310 1 . C 5 5 51310 1 . U 6 6 51310 1 . G 7 7 51310 1 . U 8 8 51310 1 . U 9 9 51310 1 . U 10 10 51310 1 . A 11 11 51310 1 . U 12 12 51310 1 . C 13 13 51310 1 . C 14 14 51310 1 . A 15 15 51310 1 . U 16 16 51310 1 . U 17 17 51310 1 . U 18 18 51310 1 . C 19 19 51310 1 . A 20 20 51310 1 . G 21 21 51310 1 . A 22 22 51310 1 . A 23 23 51310 1 . U 24 24 51310 1 . U 25 25 51310 1 . G 26 26 51310 1 . G 27 27 51310 1 . G 28 28 51310 1 . U 29 29 51310 1 . G 30 30 51310 1 . U 31 31 51310 1 . C 32 32 51310 1 . G 33 33 51310 1 . A 34 34 51310 1 . C 35 35 51310 1 . A 36 36 51310 1 . U 37 37 51310 1 . A 38 38 51310 1 . G 39 39 51310 1 . C 40 40 51310 1 . A 41 41 51310 1 . C 42 42 51310 1 . C 43 43 51310 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 51310 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 11676 organism . HIV-1 HIV-1 . . Viruses . Lentivirus HIV-1 NL4-3 . . . . . . . . . . . . 51310 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 51310 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'In vitro transcription' n/a . . . . . . . . . . . . . . . 51310 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 51310 _Sample.ID 1 _Sample.Name Sample_1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'ESS2p Equimolar mix' 'selective deuteration' . . 1 $entity_1 . . 450 . . uM . . . . 51310 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 51310 _Sample.ID 2 _Sample.Name Sample_2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'ESS2p fully protonated' 'natural abundance' . . 1 $entity_1 . . 400 . . uM . . . . 51310 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 51310 _Sample.ID 3 _Sample.Name Sample_3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 ESS2p_N15_HSQC '[U-100% 15N] on GTP and UTP' . . 1 $entity_1 . . 300 . . uM . . . . 51310 3 stop_ save_ save_sample_4 _Sample.Sf_category sample _Sample.Sf_framecode sample_4 _Sample.Entry_ID 51310 _Sample.ID 4 _Sample.Name sample_4 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '90% H2O/10% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 ESS2p_uniform_N15 '[U-100% 13C; U-100% 15N]' . . 1 $entity_1 . . 300 . . uM . . . . 51310 4 stop_ save_ save_sample_5 _Sample.Sf_category sample _Sample.Sf_framecode sample_5 _Sample.Entry_ID 51310 _Sample.ID 5 _Sample.Name Sample_5 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 ESS2p_uniform_N15_C13 '[U-100% 13C; U-100% 15N] on ATP and GTP' . . 1 $entity_1 . . 200 . . uM . . . . 51310 5 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 51310 _Sample_condition_list.ID 1 _Sample_condition_list.Name Sample_conditions_1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 5 . mM 51310 1 pH 6.5 . pH 51310 1 pressure 1 . atm 51310 1 temperature 298 . K 51310 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 51310 _Sample_condition_list.ID 2 _Sample_condition_list.Name Sample_conditions_2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 5 . mM 51310 2 pH 6.5 . pH 51310 2 pressure 1 . atm 51310 2 temperature 283 . K 51310 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 51310 _Software.ID 1 _Software.Type . _Software.Name AMBER _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 51310 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 51310 _Software.ID 2 _Software.Type . _Software.Name NMRDraw _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'Data processing' . 51310 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 51310 _Software.ID 3 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'Data processing' . 51310 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 51310 _Software.ID 4 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'Data collection' . 51310 4 stop_ save_ save_software_5 _Software.Sf_category software _Software.Sf_framecode software_5 _Software.Entry_ID 51310 _Software.ID 5 _Software.Type . _Software.Name NMRViewJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 51310 5 stop_ save_ save_software_6 _Software.Sf_category software _Software.Sf_framecode software_6 _Software.Entry_ID 51310 _Software.ID 6 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 51310 6 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 51310 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker Avance 900 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Avance II' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 900 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 51310 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name 'Bruker Avance 800 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE II' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ save_NMR_spectrometer_3 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_3 _NMR_spectrometer.Entry_ID 51310 _NMR_spectrometer.ID 3 _NMR_spectrometer.Name 'Bruker Avance NEO 700 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 51310 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no no no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 3 $NMR_spectrometer_3 . . . . . . . . . . . . . . . . H2O_NOESY 51310 1 2 '2D 1H-13C HMQC' no no no . . . . . . . . . . 5 $sample_5 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 51310 1 3 '2D 1H-1H NOESY' no no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . D2O_NOESY 51310 1 4 '2D 1H-1H TOCSY' no no no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 51310 1 5 '2D 1H-15N HSQC' no . . . . . . . . . . . . 3 $sample_3 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . . 51310 1 6 '2D 1H-15N HNN-COSY' no . . . . . . . . . . . . 4 $sample_4 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51310 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 51310 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 water protons . . . . ppm 4.7 na direct 1 . . . . . 51310 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 51310 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name ESS2p_proton_assignment _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-13C HMQC' . . . 51310 1 3 '2D 1H-1H NOESY' . . . 51310 1 4 '2D 1H-1H TOCSY' . . . 51310 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 5 $software_5 . . 51310 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.727 . . . . . . . . 1 G H1' . 51310 1 2 . 1 . 1 1 1 G H2' H 1 4.855 . . . . . . . . 1 G H2' . 51310 1 3 . 1 . 1 1 1 G H8 H 1 8.067 . . . . . . . . 1 G H8 . 51310 1 4 . 1 . 1 2 2 G H1' H 1 5.826 . . . . . . . . 2 G H1' . 51310 1 5 . 1 . 1 2 2 G H2' H 1 4.437 . . . . . . . . 2 G H2' . 51310 1 6 . 1 . 1 2 2 G H8 H 1 7.481 . . . . . . . . 2 G H8 . 51310 1 7 . 1 . 1 3 3 U H1' H 1 5.479 . . . . . . . . 3 U H1' . 51310 1 8 . 1 . 1 3 3 U H2' H 1 4.578 . . . . . . . . 3 U H2' . 51310 1 9 . 1 . 1 3 3 U H6 H 1 7.655 . . . . . . . . 3 U H6 . 51310 1 10 . 1 . 1 4 4 G H1' H 1 5.691 . . . . . . . . 4 G H1' . 51310 1 11 . 1 . 1 4 4 G H2' H 1 4.452 . . . . . . . . 4 G H2' . 51310 1 12 . 1 . 1 4 4 G H8 H 1 7.603 . . . . . . . . 4 G H8 . 51310 1 13 . 1 . 1 5 5 C H1' H 1 5.368 . . . . . . . . 5 C H1' . 51310 1 14 . 1 . 1 5 5 C H2' H 1 4.250 . . . . . . . . 5 C H2' . 51310 1 15 . 1 . 1 5 5 C H6 H 1 7.521 . . . . . . . . 5 C H6 . 51310 1 16 . 1 . 1 6 6 U H1' H 1 5.599 . . . . . . . . 6 U H1' . 51310 1 17 . 1 . 1 6 6 U H2' H 1 4.412 . . . . . . . . 6 U H2' . 51310 1 18 . 1 . 1 6 6 U H6 H 1 7.701 . . . . . . . . 6 U H6 . 51310 1 19 . 1 . 1 7 7 G H1' H 1 5.635 . . . . . . . . 7 G H1' . 51310 1 20 . 1 . 1 7 7 G H2' H 1 4.505 . . . . . . . . 7 G H2' . 51310 1 21 . 1 . 1 7 7 G H8 H 1 7.693 . . . . . . . . 7 G H8 . 51310 1 22 . 1 . 1 8 8 U H1' H 1 5.505 . . . . . . . . 8 U H1' . 51310 1 23 . 1 . 1 8 8 U H2' H 1 4.224 . . . . . . . . 8 U H2' . 51310 1 24 . 1 . 1 8 8 U H6 H 1 7.538 . . . . . . . . 8 U H6 . 51310 1 25 . 1 . 1 9 9 U H1' H 1 5.673 . . . . . . . . 9 U H1' . 51310 1 26 . 1 . 1 9 9 U H2' H 1 4.691 . . . . . . . . 9 U H2' . 51310 1 27 . 1 . 1 9 9 U H6 H 1 7.668 . . . . . . . . 9 U H6 . 51310 1 28 . 1 . 1 10 10 U H1' H 1 5.805 . . . . . . . . 10 U H1' . 51310 1 29 . 1 . 1 10 10 U H2' H 1 4.320 . . . . . . . . 10 U H2' . 51310 1 30 . 1 . 1 10 10 U H6 H 1 7.717 . . . . . . . . 10 U H6 . 51310 1 31 . 1 . 1 11 11 A H1' H 1 5.909 . . . . . . . . 11 A H1' . 51310 1 32 . 1 . 1 11 11 A H2 H 1 7.681 . . . . . . . . 11 A H2 . 51310 1 33 . 1 . 1 11 11 A H2' H 1 4.726 . . . . . . . . 11 A H2' . 51310 1 34 . 1 . 1 11 11 A H8 H 1 8.325 . . . . . . . . 11 A H8 . 51310 1 35 . 1 . 1 12 12 U H1' H 1 5.318 . . . . . . . . 12 U H1' . 51310 1 36 . 1 . 1 12 12 U H2' H 1 4.008 . . . . . . . . 12 U H2' . 51310 1 37 . 1 . 1 12 12 U H6 H 1 7.604 . . . . . . . . 12 U H6 . 51310 1 38 . 1 . 1 13 13 C H1' H 1 5.500 . . . . . . . . 13 C H1' . 51310 1 39 . 1 . 1 13 13 C H2' H 1 4.245 . . . . . . . . 13 C H2' . 51310 1 40 . 1 . 1 13 13 C H6 H 1 7.852 . . . . . . . . 13 C H6 . 51310 1 41 . 1 . 1 14 14 C H1' H 1 5.315 . . . . . . . . 14 C H1' . 51310 1 42 . 1 . 1 14 14 C H2' H 1 4.518 . . . . . . . . 14 C H2' . 51310 1 43 . 1 . 1 14 14 C H6 H 1 7.584 . . . . . . . . 14 C H6 . 51310 1 44 . 1 . 1 15 15 A H1' H 1 5.811 . . . . . . . . 15 A H1' . 51310 1 45 . 1 . 1 15 15 A H2 H 1 7.179 . . . . . . . . 15 A H2 . 51310 1 46 . 1 . 1 15 15 A H2' H 1 4.235 . . . . . . . . 15 A H2' . 51310 1 47 . 1 . 1 15 15 A H8 H 1 7.811 . . . . . . . . 15 A H8 . 51310 1 48 . 1 . 1 16 16 U H1' H 1 5.220 . . . . . . . . 16 U H1' . 51310 1 49 . 1 . 1 16 16 U H2' H 1 4.022 . . . . . . . . 16 U H2' . 51310 1 50 . 1 . 1 16 16 U H6 H 1 7.232 . . . . . . . . 16 U H6 . 51310 1 51 . 1 . 1 17 17 U H1' H 1 5.787 . . . . . . . . 17 U H1' . 51310 1 52 . 1 . 1 17 17 U H2' H 1 4.198 . . . . . . . . 17 U H2' . 51310 1 53 . 1 . 1 17 17 U H6 H 1 7.723 . . . . . . . . 17 U H6 . 51310 1 54 . 1 . 1 18 18 U H1' H 1 5.797 . . . . . . . . 18 U H1' . 51310 1 55 . 1 . 1 18 18 U H2' H 1 4.185 . . . . . . . . 18 U H2' . 51310 1 56 . 1 . 1 18 18 U H6 H 1 7.875 . . . . . . . . 18 U H6 . 51310 1 57 . 1 . 1 19 19 C H1' H 1 5.727 . . . . . . . . 19 C H1' . 51310 1 58 . 1 . 1 19 19 C H2' H 1 4.269 . . . . . . . . 19 C H2' . 51310 1 59 . 1 . 1 19 19 C H6 H 1 7.740 . . . . . . . . 19 C H6 . 51310 1 60 . 1 . 1 20 20 A H1' H 1 5.571 . . . . . . . . 20 A H1' . 51310 1 61 . 1 . 1 20 20 A H2 H 1 7.894 . . . . . . . . 20 A H2 . 51310 1 62 . 1 . 1 20 20 A H2' H 1 4.394 . . . . . . . . 20 A H2' . 51310 1 63 . 1 . 1 20 20 A H8 H 1 8.028 . . . . . . . . 20 A H8 . 51310 1 64 . 1 . 1 21 21 G H1' H 1 5.458 . . . . . . . . 21 G H1' . 51310 1 65 . 1 . 1 21 21 G H2' H 1 4.581 . . . . . . . . 21 G H2' . 51310 1 66 . 1 . 1 21 21 G H8 H 1 7.528 . . . . . . . . 21 G H8 . 51310 1 67 . 1 . 1 22 22 A H1' H 1 5.558 . . . . . . . . 22 A H1' . 51310 1 68 . 1 . 1 22 22 A H2 H 1 7.744 . . . . . . . . 22 A H2 . 51310 1 69 . 1 . 1 22 22 A H2' H 1 4.621 . . . . . . . . 22 A H2' . 51310 1 70 . 1 . 1 22 22 A H8 H 1 8.157 . . . . . . . . 22 A H8 . 51310 1 71 . 1 . 1 23 23 A H1' H 1 5.675 . . . . . . . . 23 A H1' . 51310 1 72 . 1 . 1 23 23 A H2 H 1 7.794 . . . . . . . . 23 A H2 . 51310 1 73 . 1 . 1 23 23 A H2' H 1 4.451 . . . . . . . . 23 A H2' . 51310 1 74 . 1 . 1 23 23 A H8 H 1 7.873 . . . . . . . . 23 A H8 . 51310 1 75 . 1 . 1 24 24 U H1' H 1 5.342 . . . . . . . . 24 U H1' . 51310 1 76 . 1 . 1 24 24 U H2' H 1 4.114 . . . . . . . . 24 U H2' . 51310 1 77 . 1 . 1 24 24 U H6 H 1 7.402 . . . . . . . . 24 U H6 . 51310 1 78 . 1 . 1 25 25 U H1' H 1 5.610 . . . . . . . . 25 U H1' . 51310 1 79 . 1 . 1 25 25 U H2' H 1 4.448 . . . . . . . . 25 U H2' . 51310 1 80 . 1 . 1 25 25 U H6 H 1 7.802 . . . . . . . . 25 U H6 . 51310 1 81 . 1 . 1 26 26 G H1' H 1 5.747 . . . . . . . . 26 G H1' . 51310 1 82 . 1 . 1 26 26 G H2' H 1 4.587 . . . . . . . . 26 G H2' . 51310 1 83 . 1 . 1 26 26 G H8 H 1 7.718 . . . . . . . . 26 G H8 . 51310 1 84 . 1 . 1 27 27 G H1' H 1 5.667 . . . . . . . . 27 G H1' . 51310 1 85 . 1 . 1 27 27 G H2' H 1 4.406 . . . . . . . . 27 G H2' . 51310 1 86 . 1 . 1 27 27 G H8 H 1 7.234 . . . . . . . . 27 G H8 . 51310 1 87 . 1 . 1 28 28 G H1' H 1 5.653 . . . . . . . . 28 G H1' . 51310 1 88 . 1 . 1 28 28 G H2' H 1 4.499 . . . . . . . . 28 G H2' . 51310 1 89 . 1 . 1 28 28 G H8 H 1 7.028 . . . . . . . . 28 G H8 . 51310 1 90 . 1 . 1 29 29 U H1' H 1 5.422 . . . . . . . . 29 U H1' . 51310 1 91 . 1 . 1 29 29 U H2' H 1 4.431 . . . . . . . . 29 U H2' . 51310 1 92 . 1 . 1 29 29 U H6 H 1 7.422 . . . . . . . . 29 U H6 . 51310 1 93 . 1 . 1 30 30 G H1' H 1 5.483 . . . . . . . . 30 G H1' . 51310 1 94 . 1 . 1 30 30 G H2' H 1 4.237 . . . . . . . . 30 G H2' . 51310 1 95 . 1 . 1 30 30 G H8 H 1 7.445 . . . . . . . . 30 G H8 . 51310 1 96 . 1 . 1 31 31 U H1' H 1 5.358 . . . . . . . . 31 U H1' . 51310 1 97 . 1 . 1 31 31 U H2' H 1 3.935 . . . . . . . . 31 U H2' . 51310 1 98 . 1 . 1 31 31 U H6 H 1 7.357 . . . . . . . . 31 U H6 . 51310 1 99 . 1 . 1 32 32 C H1' H 1 5.409 . . . . . . . . 32 C H1' . 51310 1 100 . 1 . 1 32 32 C H2' H 1 4.071 . . . . . . . . 32 C H2' . 51310 1 101 . 1 . 1 32 32 C H6 H 1 7.545 . . . . . . . . 32 C H6 . 51310 1 102 . 1 . 1 33 33 G H1' H 1 5.411 . . . . . . . . 33 G H1' . 51310 1 103 . 1 . 1 33 33 G H2' H 1 4.456 . . . . . . . . 33 G H2' . 51310 1 104 . 1 . 1 33 33 G H8 H 1 7.589 . . . . . . . . 33 G H8 . 51310 1 105 . 1 . 1 34 34 A H1' H 1 5.672 . . . . . . . . 34 A H1' . 51310 1 106 . 1 . 1 34 34 A H2' H 1 4.496 . . . . . . . . 34 A H2' . 51310 1 107 . 1 . 1 34 34 A H8 H 1 7.935 . . . . . . . . 34 A H8 . 51310 1 108 . 1 . 1 35 35 C H1' H 1 5.622 . . . . . . . . 35 C H1' . 51310 1 109 . 1 . 1 35 35 C H2' H 1 4.261 . . . . . . . . 35 C H2' . 51310 1 110 . 1 . 1 35 35 C H6 H 1 7.527 . . . . . . . . 35 C H6 . 51310 1 111 . 1 . 1 36 36 A H1' H 1 5.623 . . . . . . . . 36 A H1' . 51310 1 112 . 1 . 1 36 36 A H2 H 1 7.746 . . . . . . . . 36 A H2 . 51310 1 113 . 1 . 1 36 36 A H2' H 1 4.422 . . . . . . . . 36 A H2' . 51310 1 114 . 1 . 1 36 36 A H8 H 1 7.943 . . . . . . . . 36 A H8 . 51310 1 115 . 1 . 1 37 37 U H1' H 1 5.410 . . . . . . . . 37 U H1' . 51310 1 116 . 1 . 1 37 37 U H2' H 1 4.063 . . . . . . . . 37 U H2' . 51310 1 117 . 1 . 1 37 37 U H6 H 1 7.477 . . . . . . . . 37 U H6 . 51310 1 118 . 1 . 1 38 38 A H1' H 1 5.822 . . . . . . . . 38 A H1' . 51310 1 119 . 1 . 1 38 38 A H2 H 1 7.143 . . . . . . . . 38 A H2 . 51310 1 120 . 1 . 1 38 38 A H2' H 1 4.646 . . . . . . . . 38 A H2' . 51310 1 121 . 1 . 1 38 38 A H8 H 1 8.201 . . . . . . . . 38 A H8 . 51310 1 122 . 1 . 1 39 39 G H1' H 1 5.509 . . . . . . . . 39 G H1' . 51310 1 123 . 1 . 1 39 39 G H2' H 1 4.327 . . . . . . . . 39 G H2' . 51310 1 124 . 1 . 1 39 39 G H8 H 1 7.274 . . . . . . . . 39 G H8 . 51310 1 125 . 1 . 1 40 40 C H1' H 1 5.382 . . . . . . . . 40 C H1' . 51310 1 126 . 1 . 1 40 40 C H2' H 1 4.367 . . . . . . . . 40 C H2' . 51310 1 127 . 1 . 1 40 40 C H6 H 1 7.556 . . . . . . . . 40 C H6 . 51310 1 128 . 1 . 1 41 41 A H1' H 1 5.847 . . . . . . . . 41 A H1' . 51310 1 129 . 1 . 1 41 41 A H2 H 1 7.331 . . . . . . . . 41 A H2 . 51310 1 130 . 1 . 1 41 41 A H2' H 1 4.449 . . . . . . . . 41 A H2' . 51310 1 131 . 1 . 1 41 41 A H8 H 1 7.960 . . . . . . . . 41 A H8 . 51310 1 132 . 1 . 1 42 42 C H1' H 1 5.317 . . . . . . . . 42 C H1' . 51310 1 133 . 1 . 1 42 42 C H2' H 1 4.010 . . . . . . . . 42 C H2' . 51310 1 134 . 1 . 1 42 42 C H6 H 1 7.437 . . . . . . . . 42 C H6 . 51310 1 135 . 1 . 1 43 43 C H1' H 1 5.459 . . . . . . . . 43 C H1' . 51310 1 136 . 1 . 1 43 43 C H2' H 1 3.883 . . . . . . . . 43 C H2' . 51310 1 137 . 1 . 1 43 43 C H6 H 1 7.539 . . . . . . . . 43 C H6 . 51310 1 stop_ save_