data_51349 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 51349 _Entry.Title ; NPSL2_Frag2 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2022-03-07 _Entry.Accession_date 2022-03-07 _Entry.Last_release_date 2022-03-07 _Entry.Original_release_date 2022-03-07 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Yaping Liu . . . . 51349 2 Sarah Keane . C. . . 51349 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 2 51349 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 29 51349 '1H chemical shifts' 170 51349 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2022-06-07 2022-03-07 update author 'add author sequence' 51349 1 . . 2022-03-31 2022-03-07 original author 'original release' 51349 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 51348 'NPSL2 Frag1' 51349 BMRB 51350 NPSL2 51349 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 51349 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Solution structure of NPSL2, a regulatory element in the oncomiR-1 RNA ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'J. Mol. Biol.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Yaping Liu . . . . 51349 1 2 Aldrex Munsayac . . . . 51349 1 3 Ian Hall . . . . 51349 1 4 Sarah Keane . C. . . 51349 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 51349 _Assembly.ID 1 _Assembly.Name NPSL2_Frag2 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 NPSL2_Frag2 1 $entity_1 . . yes native no no . . . 51349 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 51349 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAGGGAAACUCAAACCCCU CC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 105 G . 51349 1 2 106 G . 51349 1 3 16 A . 51349 1 4 17 G . 51349 1 5 18 G . 51349 1 6 19 G . 51349 1 7 20 A . 51349 1 8 21 A . 51349 1 9 22 A . 51349 1 10 23 C . 51349 1 11 24 U . 51349 1 12 25 C . 51349 1 13 26 A . 51349 1 14 27 A . 51349 1 15 28 A . 51349 1 16 29 C . 51349 1 17 30 C . 51349 1 18 31 C . 51349 1 19 32 C . 51349 1 20 33 U . 51349 1 21 107 C . 51349 1 22 108 C . 51349 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 51349 1 . G 2 2 51349 1 . A 3 3 51349 1 . G 4 4 51349 1 . G 5 5 51349 1 . G 6 6 51349 1 . A 7 7 51349 1 . A 8 8 51349 1 . A 9 9 51349 1 . C 10 10 51349 1 . U 11 11 51349 1 . C 12 12 51349 1 . A 13 13 51349 1 . A 14 14 51349 1 . A 15 15 51349 1 . C 16 16 51349 1 . C 17 17 51349 1 . C 18 18 51349 1 . C 19 19 51349 1 . U 20 20 51349 1 . C 21 21 51349 1 . C 22 22 51349 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 51349 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 51349 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 51349 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'In vitro transcription' 'In vitro' . . . . . . . . . . . . . . . 51349 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 51349 _Sample.ID 1 _Sample.Name NPSL2_Frag2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 NPSL2_Frag2 'natural abundance' . . 1 $entity_1 . . 500 . . uM . . . . 51349 1 2 'potassium phosphate' 'natural abundance' . . . . . . 50 . . mM . . . . 51349 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 51349 _Sample_condition_list.ID 1 _Sample_condition_list.Name 'condition 1' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.05 . M 51349 1 pH 7.5 . pH 51349 1 pressure 1 . atm 51349 1 temperature 298 . K 51349 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 51349 _Sample_condition_list.ID 2 _Sample_condition_list.Name 'condition 2' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.05 . M 51349 2 pH 7.5 . pH 51349 2 pressure 1 . atm 51349 2 temperature 288 . K 51349 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 51349 _Software.ID 1 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 51349 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 51349 _Software.ID 2 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 51349 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 51349 _Software.ID 3 _Software.Type . _Software.Name 'NMRFx Analyst' _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 51349 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 51349 _Software.ID 4 _Software.Type . _Software.Name NMRViewJ _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 51349 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 51349 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker 600' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 51349 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-13C HMQC' yes . . . . . . . . . . . . 1 $sample_1 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51349 1 2 '2D 1H-1H TOCSY' yes . . . . . . . . . . . . 1 $sample_1 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51349 1 3 '2D 1H-1H NOESY' yes . . . . . . . . . . . . 1 $sample_1 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51349 1 4 '2D 1H-13C HMQC' yes . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51349 1 5 '2D 1H-1H NOESY' yes . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 51349 1 stop_ loop_ _Experiment_file.Experiment_ID _Experiment_file.Experiment_name _Experiment_file.Name _Experiment_file.Type _Experiment_file.Content _Experiment_file.Directory_path _Experiment_file.Details _Experiment_file.Entry_ID _Experiment_file.Experiment_list_ID 1 '2D 1H-13C HMQC' NPSL2_Frag2_HMQC_15_degree.zip . 'Time-domain (raw spectral data)' . . 51349 1 2 '2D 1H-1H TOCSY' NPSL2_Frag2_TOCSY-25_degree.zip . 'Time-domain (raw spectral data)' . . 51349 1 2 '2D 1H-1H TOCSY' NPSL2_Frag2_TOCSY_15_degree.zip . 'Time-domain (raw spectral data)' . . 51349 1 5 '2D 1H-1H NOESY' NPSL2_Frag2_NOESY_15_degree.zip . 'Time-domain (raw spectral data)' . . 51349 1 5 '2D 1H-1H NOESY' NPSL2_Frag2_NOESY_25_degree.zip . 'Time-domain (raw spectral data)' . . 51349 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 51349 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 'NPSL2_Frag2 reference' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 water protons . . . . ppm 4.702 na indirect . . . . . . 51349 1 H 1 water protons . . . . ppm 4.702 internal direct 1 . . . . . 51349 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 51349 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name NPSL2_Frag2 _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-13C HMQC' . . . 51349 1 2 '2D 1H-1H TOCSY' . . . 51349 1 3 '2D 1H-1H NOESY' . . . 51349 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 51349 1 2 $software_2 . . 51349 1 3 $software_3 . . 51349 1 4 $software_4 . . 51349 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.8082 0.0000 . 1 . . . . . 105 G H1' . 51349 1 2 . 1 . 1 1 1 G H2' H 1 4.9214 0.0000 . 1 . . . . . 105 G H2' . 51349 1 3 . 1 . 1 1 1 G H3' H 1 4.7156 0.0000 . 1 . . . . . 105 G H3' . 51349 1 4 . 1 . 1 1 1 G H8 H 1 8.1492 0.0000 . 1 . . . . . 105 G H8 . 51349 1 5 . 1 . 1 1 1 G C8 C 13 139.9701 0.0000 . 1 . . . . . 105 G C8 . 51349 1 6 . 1 . 1 2 2 G H1' H 1 5.8913 0.0000 . 1 . . . . . 106 G H1' . 51349 1 7 . 1 . 1 2 2 G H2' H 1 4.7076 0.0000 . 1 . . . . . 106 G H2' . 51349 1 8 . 1 . 1 2 2 G H3' H 1 4.6232 0.0000 . 1 . . . . . 106 G H3' . 51349 1 9 . 1 . 1 2 2 G H8 H 1 7.4776 0.0000 . 1 . . . . . 106 G H8 . 51349 1 10 . 1 . 1 2 2 G C8 C 13 137.4690 0.0000 . 1 . . . . . 106 G C8 . 51349 1 11 . 1 . 1 3 3 A H1' H 1 5.9641 0.0000 . 1 . . . . . 16 A H1' . 51349 1 12 . 1 . 1 3 3 A H2 H 1 7.4192 0.0000 . 1 . . . . . 16 A H2 . 51349 1 13 . 1 . 1 3 3 A H2' H 1 4.6710 0.0000 . 1 . . . . . 16 A H2' . 51349 1 14 . 1 . 1 3 3 A H3' H 1 4.6248 0.0000 . 1 . . . . . 16 A H3' . 51349 1 15 . 1 . 1 3 3 A H8 H 1 7.7439 0.0000 . 1 . . . . . 16 A H8 . 51349 1 16 . 1 . 1 3 3 A C2 C 13 153.8169 0.0000 . 1 . . . . . 16 A C2 . 51349 1 17 . 1 . 1 3 3 A C8 C 13 139.7782 0.0000 . 1 . . . . . 16 A C8 . 51349 1 18 . 1 . 1 4 4 G H1' H 1 5.6189 0.0000 . 1 . . . . . 17 G H1' . 51349 1 19 . 1 . 1 4 4 G H2' H 1 4.5244 0.0000 . 1 . . . . . 17 G H2' . 51349 1 20 . 1 . 1 4 4 G H3' H 1 4.4239 0.0000 . 1 . . . . . 17 G H3' . 51349 1 21 . 1 . 1 4 4 G H8 H 1 7.0628 0.0000 . 1 . . . . . 17 G H8 . 51349 1 22 . 1 . 1 4 4 G C8 C 13 136.3144 0.0000 . 1 . . . . . 17 G C8 . 51349 1 23 . 1 . 1 5 5 G H1' H 1 5.7159 0.0000 . 1 . . . . . 18 G H1' . 51349 1 24 . 1 . 1 5 5 G H2' H 1 4.5652 0.0000 . 1 . . . . . 18 G H2' . 51349 1 25 . 1 . 1 5 5 G H3' H 1 4.4268 0.0000 . 1 . . . . . 18 G H3' . 51349 1 26 . 1 . 1 5 5 G H8 H 1 7.0617 0.0000 . 1 . . . . . 18 G H8 . 51349 1 27 . 1 . 1 5 5 G C8 C 13 136.3857 0.0000 . 1 . . . . . 18 G C8 . 51349 1 28 . 1 . 1 6 6 G H1' H 1 5.6690 0.0000 . 1 . . . . . 19 G H1' . 51349 1 29 . 1 . 1 6 6 G H2' H 1 4.4032 0.0000 . 1 . . . . . 19 G H2' . 51349 1 30 . 1 . 1 6 6 G H3' H 1 4.5732 0.0000 . 1 . . . . . 19 G H3' . 51349 1 31 . 1 . 1 6 6 G H8 H 1 6.9971 0.0000 . 1 . . . . . 19 G H8 . 51349 1 32 . 1 . 1 6 6 G C8 C 13 136.6138 0.0000 . 1 . . . . . 19 G C8 . 51349 1 33 . 1 . 1 7 7 A H1' H 1 5.7911 0.0000 . 1 . . . . . 20 A H1' . 51349 1 34 . 1 . 1 7 7 A H2 H 1 8.0324 0.0000 . 1 . . . . . 20 A H2 . 51349 1 35 . 1 . 1 7 7 A H2' H 1 4.5530 0.0000 . 1 . . . . . 20 A H2' . 51349 1 36 . 1 . 1 7 7 A H3' H 1 4.6136 0.0000 . 1 . . . . . 20 A H3' . 51349 1 37 . 1 . 1 7 7 A H8 H 1 7.6508 0.0000 . 1 . . . . . 20 A H8 . 51349 1 38 . 1 . 1 7 7 A C2 C 13 155.5175 0.0000 . 1 . . . . . 20 A C2 . 51349 1 39 . 1 . 1 7 7 A C8 C 13 139.6784 0.0000 . 1 . . . . . 20 A C8 . 51349 1 40 . 1 . 1 8 8 A H1' H 1 5.7935 0.0000 . 1 . . . . . 21 A H1' . 51349 1 41 . 1 . 1 8 8 A H2 H 1 7.8652 0.0000 . 1 . . . . . 21 A H2 . 51349 1 42 . 1 . 1 8 8 A H2' H 1 4.6184 0.0000 . 1 . . . . . 21 A H2' . 51349 1 43 . 1 . 1 8 8 A H3' H 1 4.5753 0.0000 . 1 . . . . . 21 A H3' . 51349 1 44 . 1 . 1 8 8 A H8 H 1 7.8036 0.0000 . 1 . . . . . 21 A H8 . 51349 1 45 . 1 . 1 8 8 A C2 C 13 155.2452 0.0000 . 1 . . . . . 21 A C2 . 51349 1 46 . 1 . 1 8 8 A C8 C 13 140.2200 0.0000 . 1 . . . . . 21 A C8 . 51349 1 47 . 1 . 1 9 9 A H1' H 1 5.7914 0.0000 . 1 . . . . . 22 A H1' . 51349 1 48 . 1 . 1 9 9 A H2 H 1 8.0508 0.0000 . 1 . . . . . 22 A H2 . 51349 1 49 . 1 . 1 9 9 A H2' H 1 4.4367 0.0000 . 1 . . . . . 22 A H2' . 51349 1 50 . 1 . 1 9 9 A H3' H 1 4.5483 0.0000 . 1 . . . . . 22 A H3' . 51349 1 51 . 1 . 1 9 9 A H8 H 1 7.9197 0.0000 . 1 . . . . . 22 A H8 . 51349 1 52 . 1 . 1 9 9 A C2 C 13 155.5902 0.0000 . 1 . . . . . 22 A C2 . 51349 1 53 . 1 . 1 9 9 A C8 C 13 140.5100 0.0000 . 1 . . . . . 22 A C8 . 51349 1 54 . 1 . 1 10 10 C H1' H 1 5.6379 0.0000 . 1 . . . . . 23 C H1' . 51349 1 55 . 1 . 1 10 10 C H2' H 1 4.1689 0.0000 . 1 . . . . . 23 C H2' . 51349 1 56 . 1 . 1 10 10 C H3' H 1 4.3251 0.0000 . 1 . . . . . 23 C H3' . 51349 1 57 . 1 . 1 10 10 C H5 H 1 5.5227 0.0000 . 1 . . . . . 23 C H5 . 51349 1 58 . 1 . 1 10 10 C H6 H 1 7.5558 0.0000 . 1 . . . . . 23 C H6 . 51349 1 59 . 1 . 1 10 10 C C6 C 13 142.7288 0.0000 . 1 . . . . . 23 C C6 . 51349 1 60 . 1 . 1 11 11 U H1' H 1 5.6824 0.0000 . 1 . . . . . 24 U H1' . 51349 1 61 . 1 . 1 11 11 U H2' H 1 4.4303 0.0000 . 1 . . . . . 24 U H2' . 51349 1 62 . 1 . 1 11 11 U H3' H 1 4.5068 0.0000 . 1 . . . . . 24 U H3' . 51349 1 63 . 1 . 1 11 11 U H5 H 1 5.5753 0.0000 . 1 . . . . . 24 U H5 . 51349 1 64 . 1 . 1 11 11 U H6 H 1 7.6891 0.0000 . 1 . . . . . 24 U H6 . 51349 1 65 . 1 . 1 11 11 U C6 C 13 143.7836 0.0000 . 1 . . . . . 24 U C6 . 51349 1 66 . 1 . 1 12 12 C H1' H 1 5.6233 0.0000 . 1 . . . . . 25 C H1' . 51349 1 67 . 1 . 1 12 12 C H2' H 1 4.4498 0.0000 . 1 . . . . . 25 C H2' . 51349 1 68 . 1 . 1 12 12 C H3' H 1 4.4785 0.0000 . 1 . . . . . 25 C H3' . 51349 1 69 . 1 . 1 12 12 C H5 H 1 5.6154 0.0000 . 1 . . . . . 25 C H5 . 51349 1 70 . 1 . 1 12 12 C H6 H 1 7.6254 0.0000 . 1 . . . . . 25 C H6 . 51349 1 71 . 1 . 1 12 12 C C6 C 13 143.0994 0.0000 . 1 . . . . . 25 C C6 . 51349 1 72 . 1 . 1 13 13 A H1' H 1 5.8111 0.0000 . 1 . . . . . 26 A H1' . 51349 1 73 . 1 . 1 13 13 A H2 H 1 7.6899 0.0000 . 1 . . . . . 26 A H2 . 51349 1 74 . 1 . 1 13 13 A H2' H 1 4.7319 0.0000 . 1 . . . . . 26 A H2' . 51349 1 75 . 1 . 1 13 13 A H3' H 1 4.7499 0.0000 . 1 . . . . . 26 A H3' . 51349 1 76 . 1 . 1 13 13 A H8 H 1 8.1677 0.0000 . 1 . . . . . 26 A H8 . 51349 1 77 . 1 . 1 13 13 A C2 C 13 154.8997 0.0000 . 1 . . . . . 26 A C2 . 51349 1 78 . 1 . 1 13 13 A C8 C 13 141.4298 0.0000 . 1 . . . . . 26 A C8 . 51349 1 79 . 1 . 1 14 14 A H1' H 1 5.6763 0.0000 . 1 . . . . . 27 A H1' . 51349 1 80 . 1 . 1 14 14 A H2 H 1 7.7320 0.0000 . 1 . . . . . 27 A H2 . 51349 1 81 . 1 . 1 14 14 A H2' H 1 4.6447 0.0000 . 1 . . . . . 27 A H2' . 51349 1 82 . 1 . 1 14 14 A H3' H 1 4.6578 0.0000 . 1 . . . . . 27 A H3' . 51349 1 83 . 1 . 1 14 14 A H8 H 1 7.9598 0.0000 . 1 . . . . . 27 A H8 . 51349 1 84 . 1 . 1 14 14 A C2 C 13 154.7961 0.0000 . 1 . . . . . 27 A C2 . 51349 1 85 . 1 . 1 14 14 A C8 C 13 140.7389 0.0000 . 1 . . . . . 27 A C8 . 51349 1 86 . 1 . 1 15 15 A H1' H 1 5.7346 0.0000 . 1 . . . . . 28 A H1' . 51349 1 87 . 1 . 1 15 15 A H2 H 1 8.0331 0.0000 . 1 . . . . . 28 A H2 . 51349 1 88 . 1 . 1 15 15 A H2' H 1 4.5072 0.0000 . 1 . . . . . 28 A H2' . 51349 1 89 . 1 . 1 15 15 A H3' H 1 4.5550 0.0000 . 1 . . . . . 28 A H3' . 51349 1 90 . 1 . 1 15 15 A H8 H 1 7.9375 0.0000 . 1 . . . . . 28 A H8 . 51349 1 91 . 1 . 1 15 15 A C2 C 13 155.4897 0.0000 . 1 . . . . . 28 A C2 . 51349 1 92 . 1 . 1 15 15 A C8 C 13 140.5639 0.0000 . 1 . . . . . 28 A C8 . 51349 1 93 . 1 . 1 16 16 C H1' H 1 5.5813 0.0000 . 1 . . . . . 29 C H1' . 51349 1 94 . 1 . 1 16 16 C H2' H 1 4.2634 0.0000 . 1 . . . . . 29 C H2' . 51349 1 95 . 1 . 1 16 16 C H3' H 1 4.4415 0.0000 . 1 . . . . . 29 C H3' . 51349 1 96 . 1 . 1 16 16 C H5 H 1 5.4082 0.0000 . 1 . . . . . 29 C H5 . 51349 1 97 . 1 . 1 16 16 C H6 H 1 7.4771 0.0000 . 1 . . . . . 29 C H6 . 51349 1 98 . 1 . 1 16 16 C C6 C 13 141.6362 0.0000 . 1 . . . . . 29 C C6 . 51349 1 99 . 1 . 1 17 17 C H1' H 1 5.5874 0.0000 . 1 . . . . . 30 C H1' . 51349 1 100 . 1 . 1 17 17 C H2' H 1 4.4080 0.0000 . 1 . . . . . 30 C H2' . 51349 1 101 . 1 . 1 17 17 C H3' H 1 4.5299 0.0000 . 1 . . . . . 30 C H3' . 51349 1 102 . 1 . 1 17 17 C H5 H 1 5.7553 0.0000 . 1 . . . . . 30 C H5 . 51349 1 103 . 1 . 1 17 17 C H6 H 1 7.8604 0.0000 . 1 . . . . . 30 C H6 . 51349 1 104 . 1 . 1 17 17 C C6 C 13 142.3738 0.0000 . 1 . . . . . 30 C C6 . 51349 1 105 . 1 . 1 18 18 C H1' H 1 5.4844 0.0000 . 1 . . . . . 31 C H1' . 51349 1 106 . 1 . 1 18 18 C H2' H 1 4.4702 0.0000 . 1 . . . . . 31 C H2' . 51349 1 107 . 1 . 1 18 18 C H3' H 1 4.4917 0.0000 . 1 . . . . . 31 C H3' . 51349 1 108 . 1 . 1 18 18 C H5 H 1 5.4848 0.0000 . 1 . . . . . 31 C H5 . 51349 1 109 . 1 . 1 18 18 C H6 H 1 7.8667 0.0000 . 1 . . . . . 31 C H6 . 51349 1 110 . 1 . 1 18 18 C C6 C 13 142.2156 0.0000 . 1 . . . . . 31 C C6 . 51349 1 111 . 1 . 1 19 19 C H1' H 1 5.4475 0.0000 . 1 . . . . . 32 C H1' . 51349 1 112 . 1 . 1 19 19 C H2' H 1 4.3948 0.0000 . 1 . . . . . 32 C H2' . 51349 1 113 . 1 . 1 19 19 C H3' H 1 4.5036 0.0000 . 1 . . . . . 32 C H3' . 51349 1 114 . 1 . 1 19 19 C H5 H 1 5.4476 0.0000 . 1 . . . . . 32 C H5 . 51349 1 115 . 1 . 1 19 19 C H6 H 1 7.8221 0.0000 . 1 . . . . . 32 C H6 . 51349 1 116 . 1 . 1 19 19 C C6 C 13 142.2014 0.0000 . 1 . . . . . 32 C C6 . 51349 1 117 . 1 . 1 20 20 U H1' H 1 5.5042 0.0000 . 1 . . . . . 33 U H1' . 51349 1 118 . 1 . 1 20 20 U H2' H 1 4.5095 0.0000 . 1 . . . . . 33 U H2' . 51349 1 119 . 1 . 1 20 20 U H3' H 1 4.5263 0.0000 . 1 . . . . . 33 U H3' . 51349 1 120 . 1 . 1 20 20 U H5 H 1 5.3891 0.0000 . 1 . . . . . 33 U H5 . 51349 1 121 . 1 . 1 20 20 U H6 H 1 7.9376 0.0000 . 1 . . . . . 33 U H6 . 51349 1 122 . 1 . 1 20 20 U C6 C 13 143.0593 0.0000 . 1 . . . . . 33 U C6 . 51349 1 123 . 1 . 1 21 21 C H1' H 1 5.5437 0.0000 . 1 . . . . . 107 C H1' . 51349 1 124 . 1 . 1 21 21 C H2' H 1 4.1881 0.0000 . 1 . . . . . 107 C H2' . 51349 1 125 . 1 . 1 21 21 C H3' H 1 4.4685 0.0000 . 1 . . . . . 107 C H3' . 51349 1 126 . 1 . 1 21 21 C H5 H 1 5.6191 0.0000 . 1 . . . . . 107 C H5 . 51349 1 127 . 1 . 1 21 21 C H6 H 1 7.9184 0.0000 . 1 . . . . . 107 C H6 . 51349 1 128 . 1 . 1 21 21 C C6 C 13 142.6876 0.0000 . 1 . . . . . 107 C C6 . 51349 1 129 . 1 . 1 22 22 C H1' H 1 5.6751 0.0000 . 1 . . . . . 108 C H1' . 51349 1 130 . 1 . 1 22 22 C H2' H 1 4.0180 0.0000 . 1 . . . . . 108 C H2' . 51349 1 131 . 1 . 1 22 22 C H3' H 1 4.1989 0.0000 . 1 . . . . . 108 C H3' . 51349 1 132 . 1 . 1 22 22 C H5 H 1 5.4376 0.0000 . 1 . . . . . 108 C H5 . 51349 1 133 . 1 . 1 22 22 C H6 H 1 7.6309 0.0000 . 1 . . . . . 108 C H6 . 51349 1 134 . 1 . 1 22 22 C C6 C 13 142.7858 0.0000 . 1 . . . . . 108 C C6 . 51349 1 stop_ save_ save_assigned_chemical_shifts_2 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_2 _Assigned_chem_shift_list.Entry_ID 51349 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Name NPSL2_Frag2 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 4 '2D 1H-13C HMQC' . . . 51349 2 5 '2D 1H-1H NOESY' . . . 51349 2 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 51349 2 2 $software_2 . . 51349 2 3 $software_3 . . 51349 2 4 $software_4 . . 51349 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.8278 0.0000 . 1 . . . . . 105 G H1' . 51349 2 2 . 1 . 1 1 1 G H2' H 1 4.9463 0.0000 . 1 . . . . . 105 G H2' . 51349 2 3 . 1 . 1 1 1 G H3' H 1 4.7548 0.0000 . 1 . . . . . 105 G H3' . 51349 2 4 . 1 . 1 1 1 G H8 H 1 8.1764 0.0000 . 1 . . . . . 105 G H8 . 51349 2 5 . 1 . 1 2 2 G H1' H 1 5.9022 0.0000 . 1 . . . . . 106 G H1' . 51349 2 6 . 1 . 1 2 2 G H2' H 1 4.7548 0.0000 . 1 . . . . . 106 G H2' . 51349 2 7 . 1 . 1 2 2 G H3' H 1 4.6590 0.0000 . 1 . . . . . 106 G H3' . 51349 2 8 . 1 . 1 2 2 G H8 H 1 7.5150 0.0000 . 1 . . . . . 106 G H8 . 51349 2 9 . 1 . 1 3 3 A H1' H 1 5.9812 0.0000 . 1 . . . . . 16 A H1' . 51349 2 10 . 1 . 1 3 3 A H2 H 1 7.4488 0.0000 . 1 . . . . . 16 A H2 . 51349 2 11 . 1 . 1 3 3 A H8 H 1 7.7536 0.0000 . 1 . . . . . 16 A H8 . 51349 2 12 . 1 . 1 4 4 G H1' H 1 5.6353 0.0000 . 1 . . . . . 17 G H1' . 51349 2 13 . 1 . 1 4 4 G H8 H 1 7.0911 0.0000 . 1 . . . . . 17 G H8 . 51349 2 14 . 1 . 1 5 5 G H1' H 1 5.7322 0.0000 . 1 . . . . . 18 G H1' . 51349 2 15 . 1 . 1 5 5 G H8 H 1 7.0865 0.0000 . 1 . . . . . 18 G H8 . 51349 2 16 . 1 . 1 6 6 G H1' H 1 5.6739 0.0000 . 1 . . . . . 19 G H1' . 51349 2 17 . 1 . 1 6 6 G H8 H 1 6.9975 0.0000 . 1 . . . . . 19 G H8 . 51349 2 18 . 1 . 1 7 7 A H1' H 1 5.7888 0.0000 . 1 . . . . . 20 A H1' . 51349 2 19 . 1 . 1 7 7 A H2 H 1 8.0190 0.0000 . 1 . . . . . 20 A H2 . 51349 2 20 . 1 . 1 7 7 A H8 H 1 7.6845 0.0000 . 1 . . . . . 20 A H8 . 51349 2 21 . 1 . 1 8 8 A H1' H 1 5.8076 0.0000 . 1 . . . . . 21 A H1' . 51349 2 22 . 1 . 1 8 8 A H2 H 1 7.8427 0.0000 . 1 . . . . . 21 A H2 . 51349 2 23 . 1 . 1 8 8 A H8 H 1 7.8388 0.0000 . 1 . . . . . 21 A H8 . 51349 2 24 . 1 . 1 9 9 A H1' H 1 5.8079 0.0000 . 1 . . . . . 22 A H1' . 51349 2 25 . 1 . 1 9 9 A H2 H 1 8.0448 0.0000 . 1 . . . . . 22 A H2 . 51349 2 26 . 1 . 1 9 9 A H8 H 1 7.9734 0.0000 . 1 . . . . . 22 A H8 . 51349 2 27 . 1 . 1 10 10 C H1' H 1 5.6765 0.0000 . 1 . . . . . 23 C H1' . 51349 2 28 . 1 . 1 10 10 C H5 H 1 5.5845 0.0000 . 1 . . . . . 23 C H5 . 51349 2 29 . 1 . 1 10 10 C H6 H 1 7.6019 0.0000 . 1 . . . . . 23 C H6 . 51349 2 30 . 1 . 1 11 11 U H1' H 1 5.7309 0.0000 . 1 . . . . . 24 U H1' . 51349 2 31 . 1 . 1 11 11 U H5 H 1 5.6379 0.0000 . 1 . . . . . 24 U H5 . 51349 2 32 . 1 . 1 11 11 U H6 H 1 7.6983 0.0000 . 1 . . . . . 24 U H6 . 51349 2 33 . 1 . 1 12 12 C H1' H 1 5.6739 0.0000 . 1 . . . . . 25 C H1' . 51349 2 34 . 1 . 1 12 12 C H5 H 1 5.6929 0.0000 . 1 . . . . . 25 C H5 . 51349 2 35 . 1 . 1 12 12 C H6 H 1 7.6202 0.0000 . 1 . . . . . 25 C H6 . 51349 2 36 . 1 . 1 13 13 A H1' H 1 5.8262 0.0000 . 1 . . . . . 26 A H1' . 51349 2 37 . 1 . 1 13 13 A H2 H 1 7.7346 0.0000 . 1 . . . . . 26 A H2 . 51349 2 38 . 1 . 1 13 13 A H8 H 1 8.1772 0.0000 . 1 . . . . . 26 A H8 . 51349 2 39 . 1 . 1 14 14 A H1' H 1 5.7499 0.0000 . 1 . . . . . 27 A H1' . 51349 2 40 . 1 . 1 14 14 A H2 H 1 7.7450 0.0000 . 1 . . . . . 27 A H2 . 51349 2 41 . 1 . 1 14 14 A H8 H 1 8.0152 0.0000 . 1 . . . . . 27 A H8 . 51349 2 42 . 1 . 1 15 15 A H1' H 1 5.7700 0.0000 . 1 . . . . . 28 A H1' . 51349 2 43 . 1 . 1 15 15 A H2 H 1 8.0186 0.0000 . 1 . . . . . 28 A H2 . 51349 2 44 . 1 . 1 15 15 A H8 H 1 7.9969 0.0000 . 1 . . . . . 28 A H8 . 51349 2 45 . 1 . 1 16 16 C H1' H 1 5.6481 0.0000 . 1 . . . . . 29 C H1' . 51349 2 46 . 1 . 1 16 16 C H5 H 1 5.4829 0.0000 . 1 . . . . . 29 C H5 . 51349 2 47 . 1 . 1 16 16 C H6 H 1 7.5432 0.0000 . 1 . . . . . 29 C H6 . 51349 2 48 . 1 . 1 17 17 C H1' H 1 5.4838 0.0000 . 1 . . . . . 30 C H1' . 51349 2 49 . 1 . 1 17 17 C H5 H 1 5.8268 0.0000 . 1 . . . . . 30 C H5 . 51349 2 50 . 1 . 1 17 17 C H6 H 1 7.9000 0.0000 . 1 . . . . . 30 C H6 . 51349 2 51 . 1 . 1 18 18 C H1' H 1 5.4993 0.0000 . 1 . . . . . 31 C H1' . 51349 2 52 . 1 . 1 18 18 C H5 H 1 5.5214 0.0000 . 1 . . . . . 31 C H5 . 51349 2 53 . 1 . 1 18 18 C H6 H 1 7.8780 0.0000 . 1 . . . . . 31 C H6 . 51349 2 54 . 1 . 1 19 19 C H1' H 1 5.4638 0.0000 . 1 . . . . . 32 C H1' . 51349 2 55 . 1 . 1 19 19 C H5 H 1 5.4890 0.0000 . 1 . . . . . 32 C H5 . 51349 2 56 . 1 . 1 19 19 C H6 H 1 7.8342 0.0000 . 1 . . . . . 32 C H6 . 51349 2 57 . 1 . 1 20 20 U H1' H 1 5.5201 0.0000 . 1 . . . . . 33 U H1' . 51349 2 58 . 1 . 1 20 20 U H5 H 1 5.4049 0.0000 . 1 . . . . . 33 U H5 . 51349 2 59 . 1 . 1 20 20 U H6 H 1 7.9545 0.0000 . 1 . . . . . 33 U H6 . 51349 2 60 . 1 . 1 21 21 C H1' H 1 5.5584 0.0000 . 1 . . . . . 107 C H1' . 51349 2 61 . 1 . 1 21 21 C H5 H 1 5.6557 0.0000 . 1 . . . . . 107 C H5 . 51349 2 62 . 1 . 1 21 21 C H6 H 1 7.9212 0.0000 . 1 . . . . . 107 C H6 . 51349 2 63 . 1 . 1 22 22 C H1' H 1 5.7899 0.0000 . 1 . . . . . 108 C H1' . 51349 2 64 . 1 . 1 22 22 C H5 H 1 5.4648 0.0000 . 1 . . . . . 108 C H5 . 51349 2 65 . 1 . 1 22 22 C H6 H 1 7.6545 0.0000 . 1 . . . . . 108 C H6 . 51349 2 stop_ save_