BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 95

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDEntry TitleCarbon shiftsNitrogen shiftsPhosphorus shiftsHydrogen shiftsOther shiftsProteinDNARNAOther
4141vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant291100189040XX
4172Response Element of the Orphan Nuclear Receptor Rev-erb Beta00282680X
4235NMR Solution Structure of [d(GCGAATTCGC)2]009820X
4243Intercalated d(TCCCGTTTCCA) dimer0010840X
4244NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]009940X
4361Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints80071520XX
4362Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints96071600XX
4415Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.00221930X
4416Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.00221930X
4547Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)00161680XX
455531P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes00262430X
455631P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes00141370X
4646Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY00171440X
4692SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT00212450X
4746Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt80071270XX
4753Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc96071350XX
5134Solution Structure of dAAUAA DNA Bulge00272480X
5135Solution Structure of dAATAA DNA Bulge00262410X
5245Heteroduplex of chirally pure R-methylphosphonate/DNA duplex00131090X
5282Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings3596680X
5671Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy002200X
5681DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)008910X
6009NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+00141620X
62731H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'00101010X
64301H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del00151480X
15033Dimeric solution structure of the cyclic octamer d(CCGTCCGT)2004430X
15360Solution Structures of a DNA Dodecamer Duplex00222660X
15376SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE00151700X
155271H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-11160252270X
15898H1, C13, 31P chemical shifts of dGCGAAAGC4207720X
16225Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA00202310X
16282d(AGAGCTCT)2 assignments007480X
16286d(CGAGCTCG)2 assignments007460X
16289d(GCTATAGC)2 assignments007480X
17129Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.1390252540X
17535DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage360161301XX
17887DNA sequence context conceals alpha anomeric lesion560181770X
18040DNA TT mismatch and 2,7-BisNP00202020X
18050Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch0091790X
18279human CEB25 minisatellite G-quadruplex560252330X
18973DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer00201790X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201790X
18981DNA containing a cluster of 8-oxo-guanine and THF lesion00211850X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)00201820X
18985DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)00201820X
19158Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions00183490X
19159Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions00224280X
19222NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout0026400X
19387Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative00232100X
19440NMR structure of DNA duplex00141600X
19441NMR structure of spermine modified DNA duplex00141640X
19734Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell390500XX
19784Solution structure of the G-triplex truncated-TBA66091190X
25723Universal Base oligonucleotide structure00161360X
25724Universal base control oligonucleotide structure00161330X
30038Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position00141860X
30044Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position00141860X
30052NMR solution structure of [Rp, Rp]-PT dsDNA00181440X
30053Solution NMR structure of PT-free dsDNA from Streptomyces lividans00161560X
30054NMR solution structure of [Sp, Sp]-PT dsDNA00181120X
30105Structural impact of single ribonucleotides in DNA00161280XX
30111Structural impact of single ribonucleotides in DNA00161290X
30112Structural impact of single ribonucleotides in DNA00161290X
30113Structural impact of single ribonucleotides in DNA00161280XX
30114Structural impact of single ribonucleotides in DNA00161280XX
30115Structural impact of single ribonucleotides in DNA00161280XX
30116Structural impact of single ribonucleotides in DNA00161280XX
30117Structural impact of single ribonucleotides in DNA00161280XX
30253Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure11310221550X
30254Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure11510221610X
30255Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure11510201600X
30473NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)700101640X
30940Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide00121770XX
34157NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies1070223530X
34158NtiPr polyamide in complex with 5'CGATGTACTACG31050223040X
34159Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies1120223500X
34328Dodecamer DNA containing the synthetic base pair P-Z72011980X
34436Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs00111150X
34438Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair00131320X
34580Single modified phosphoryl guanidine DNA duplex, Sp diastereomer110162580X
34581DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer60172120X
34685Solution structure of a lanthanide-binding DNA aptamer00797790X
34805Solution structure of the 8-17 DNAzyme in presence of Zn2+00323020X
34914Single acyclic phosphonate nucleotide (S)-ZNA modification on DNA hairpin78091030X
34915Single acyclic phosphonate nucleotide (R)-ZNA modification on DNA duplex960142420X
34942Solution structure of a silver ion mediated DNA duplex with universal 7-deazapurine substitutions0011890X
36168Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence110242360X
50610T9 DNA0088840X
50611U9 DNA00881640X
50613U8 DNA00881600X
50614dhU3 DNA00771640X
50615DDD DNA00771640X
50616A3T3 DNA0077780X
50617MeC9 DNA0077780X
523558-17 DNAzyme in presence of various metal ions0018020710X