Click here to enlarge.
PDB ID: 2kmj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, SPARTA
BMRB Entry DOI: doi:10.13018/BMR16431
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ferner, Jan; Suhartono, Marcel; Breitung, Sven; Jonker, Hendrik; Hennig, Mirko; Woehnert, Jens; Goebel, Michael; Schwalbe, Harald. "Structures of HIV TAR RNA-ligand complexes reveal higher binding stoichiometries" ChemBioChem 10, 1490-1494 (2009).
PubMed: 19444830
Assembly members:
UUCG-TAR, polymer, 28 residues, Formula weight is not available
Pyrimidinylpeptide, polymer, 3 residues, Formula weight is not available
Natural source: Common Name: AIDS virus Taxonomy ID: 11709 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: puc19
Entity Sequences (FASTA):
UUCG-TAR: GGCCAGAUUGAGCUUCGGCU
CUCUGGUC
Pyrimidinylpeptide: XXX
Data type | Count |
13C chemical shifts | 172 |
15N chemical shifts | 57 |
1H chemical shifts | 236 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | UUCG-TAR | 1 |
2 | LIG1 | 2 |
3 | LIG2 | 2 |
Entity 1, UUCG-TAR 28 residues - Formula weight is not available
1 | G | G | C | C | A | G | A | U | U | G | ||||
2 | A | G | C | U | U | C | G | G | C | U | ||||
3 | C | U | C | U | G | G | U | C |
Entity 2, LIG1 3 residues - Formula weight is not available
2X=PPA (2-amino-5-(pyrimidin-2-yl)pentanoic acid)
1 | DAR | PPA | DAR |