BMRB Entry 5528

Click here to enlarge.

PDB ID: 1m82
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5528
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Title:
Solution structure of the complementary RNA promoter of influenza a virus
Deposition date:
2002-09-13
Original release date:
2003-07-07
Authors:
Park, C.-J.; Bae, S.-H.; Varani, G.; Lee, M.-K.; Choi, B.-S.
Citation:

Citation: Park, C.-J.; Bae, S.-H.; Lee, M.-K.; Varani, G.; Choi, B.-S.. "Solution Structure of the Influenza A Virus cRNA Promoter: Implications for Differential Recognition of Viral Promoter Structures by RNA-dependent RNA Polymerase"  Nucleic Acids Res. 31, 2824-2832 (2003).
PubMed: 12771209

Assembly members:

Assembly members:
complementary RNA promoter of influenza virus, polymer, 25 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: influenza A virus   Taxonomy ID: 11320   Superkingdom: not available   Kingdom: not available   Genus/species: influenzavirus A not available

Experimental source:

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
complementary RNA promoter of influenza virus: GGAAGCAGGCUUCGGCCUUG UUUCC

Data sets:
Data typeCount
31P chemical shifts13

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1complementary RNA promoter1

Entities:

Entity 1, complementary RNA promoter 25 residues - Formula weight is not available

1   GGAAGCAGGC
2   UUCGGCCUUG
3   UUUCC