Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR6353
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kobayashi, Masakazu; Siegal, Gregg. "Letter to the Editor: 1H, 15N and 13C resonance assignments of the BRCT Region
of the large subunit of human Replication Factor C" J. Biomol. NMR 31, 183-184 (2005).
Assembly members:
RFC p140 BRCT region, polymer, 106 residues, Formula weight is not available
self - annealing hairpin - dsDNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Eschericia coli Vector: pLysS
Entity Sequences (FASTA):
RFC p140 BRCT region: KRTNYQAYRSYLNREGPKAL
GSKEIPKGAENCLEGLIFVI
TGVLESIERDEAKSLIERYG
GKVTGNVSKKTNYLVMGRDS
GQSKSDKAAALGTKIIDEDG
LLNLIR
self - annealing hairpin - dsDNA: CTCGAGGTCGTCATCGACCT
CGAGATCA
Data type | Count |
1H chemical shifts | 748 |
13C chemical shifts | 321 |
15N chemical shifts | 113 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RFC p140 375-480 BRCT region | 1 |
2 | self - annealing hairpin - dsDNA | 2 |
Entity 1, RFC p140 375-480 BRCT region 106 residues - Formula weight is not available
1 | LYS | ARG | THR | ASN | TYR | GLN | ALA | TYR | ARG | SER | ||||
2 | TYR | LEU | ASN | ARG | GLU | GLY | PRO | LYS | ALA | LEU | ||||
3 | GLY | SER | LYS | GLU | ILE | PRO | LYS | GLY | ALA | GLU | ||||
4 | ASN | CYS | LEU | GLU | GLY | LEU | ILE | PHE | VAL | ILE | ||||
5 | THR | GLY | VAL | LEU | GLU | SER | ILE | GLU | ARG | ASP | ||||
6 | GLU | ALA | LYS | SER | LEU | ILE | GLU | ARG | TYR | GLY | ||||
7 | GLY | LYS | VAL | THR | GLY | ASN | VAL | SER | LYS | LYS | ||||
8 | THR | ASN | TYR | LEU | VAL | MET | GLY | ARG | ASP | SER | ||||
9 | GLY | GLN | SER | LYS | SER | ASP | LYS | ALA | ALA | ALA | ||||
10 | LEU | GLY | THR | LYS | ILE | ILE | ASP | GLU | ASP | GLY | ||||
11 | LEU | LEU | ASN | LEU | ILE | ARG |
Entity 2, self - annealing hairpin - dsDNA 28 residues - Formula weight is not available
1 | DC | DT | DC | DG | DA | DG | DG | DT | DC | DG | ||||
2 | DT | DC | DA | DT | DC | DG | DA | DC | DC | DT | ||||
3 | DC | DG | DA | DG | DA | DT | DC | DA |
PDB | 2EBU 2K6G 2K7F |
DBJ | BAE88328 BAF84301 BAG10592 |
EMBL | CAA49475 CAA51260 CAA80355 |
GB | AAA16121 AAA21643 AAA79698 AAA81558 AAB60452 |
REF | NP_001191676 NP_002904 NP_035388 XP_001091287 XP_001140765 |
SP | P35251 P35601 |
AlphaFold | P35251 P35601 |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks