BMRB Entry 10018
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR10018
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H Chemical Shift Assignments for LINE RNA PubMed: 17000640
Deposition date: 2005-12-14 Original release date: 2006-11-21
Authors: Nomura, Yusuke; Baba, Seiki; Nakazato, Shinta; Sakamoto, Taiichi; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota
Citation: Nomura, Yusuke; Kajikawa, Masaki; Baba, Seiki; Nakazato, Shinta; Imai, T.; Sakamoto, Taiichi; Okada, Norihiro; Kawai, Gota. "Solution structure and functional importance of a conserved RNA hairpin of eel LINE UnaL2" Nucleic Acids Res. 34, 5184-5193 (2006).
Assembly members:
LINE36, polymer, 36 residues, Formula weight is not available
Natural source: Common Name: Japanese eel Taxonomy ID: 7937 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Anguilla Japonica
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
LINE36: GGUUGUACGUCGCUUUGGAU
AAAAGCGUCUGCGACC
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 178 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA hairpin of eel LINE | 1 |
Entities:
Entity 1, RNA hairpin of eel LINE 36 residues - Formula weight is not available
1 | G | G | U | U | G | U | A | C | G | U | ||||
2 | C | G | C | U | U | U | G | G | A | U | ||||
3 | A | A | A | A | G | C | G | U | C | U | ||||
4 | G | C | G | A | C | C |
Samples:
sample_1: LINE36 1.0 ± 0.1 mM
condition_1: pH: 6.0; temperature: 293 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | sample_1 | not available | condition_1 |
2D TOCSY | sample_1 | not available | condition_1 |
DQF-COSY | sample_1 | not available | condition_1 |
HP-COSY | sample_1 | not available | condition_1 |
HCP | sample_1 | not available | condition_1 |
HALF FILTERED NOESY | sample_1 | not available | condition_1 |
2D HNN-COSY | sample_1 | not available | condition_1 |
2D HSQC | sample_1 | not available | condition_1 |
2D TROSY | sample_1 | not available | condition_1 |
Software:
No software information available
NMR spectrometers:
- Bruker DRX 600 MHz
- Bruker DRX 500 MHz