Click here to enlarge.
PDB ID: 2rvo
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR11607
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Otsu, Maina; Norose, Nao; Arai, Nao; Terao, Ryo; Kajikawa, Masaki; Okada, Norihiro; Kawai, Gota. "Solution structure of a reverse transcriptase recognition site of a LINE RNA from zebrafish" .
Assembly members:
RNA_(34-MER), polymer, 34 residues, 10859.578 Da.
Natural source: Common Name: zebrafish Taxonomy ID: 7955 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Denio Renio
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(34-MER): GGCGCUUUGACACAAUCUAC
AUUGUAAAAGCGCC
Data type | Count |
13C chemical shifts | 33 |
1H chemical shifts | 97 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (34-MER) | 1 |
Entity 1, RNA (34-MER) 34 residues - 10859.578 Da.
1 | G | G | C | G | C | U | U | U | G | A | ||||
2 | C | A | C | A | A | U | C | U | A | C | ||||
3 | A | U | U | G | U | A | A | A | A | G | ||||
4 | C | G | C | C |