Click here to enlarge.
PDB ID: 2jwv
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15538
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Reiter, Nicholas; Maher, L. James; Butcher, Samuel. "DNA mimicry by a high affinity anti-NF-kB RNA apatamer" Nucleic Acids Res. 36, 1227-1236 (2008).
PubMed: 18160411
Assembly members:
RNA, polymer, 29 residues, 132.116 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: not applicable Vector: T7 RNA polymerase
Entity Sequences (FASTA):
RNA: GAUACUUGAAACUGUAAGGU
UGGCGUAUC
Data type | Count |
13C chemical shifts | 193 |
15N chemical shifts | 31 |
1H chemical shifts | 256 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA | 1 |
Entity 1, RNA 29 residues - 132.116 Da.
1 | G | A | U | A | C | U | U | G | A | A | ||||
2 | A | C | U | G | U | A | A | G | G | U | ||||
3 | U | G | G | C | G | U | A | U | C |