BMRB Entry 16941
Click here to enlarge.
PDB ID: 2kx5
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16941
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Davidson, Amy; Patora-Komisarska, Krystyna; Robinson, John; Varani, Gabriele. "Essential structural requirements for specific recognition of HIV TAR RNA by peptide mimetics of Tat protein." Nucleic Acids Res. 39, 248-256 (2011).
PubMed: 20724442
Assembly members:
HIV-1_TAR/KP-Z-41, polymer, 29 residues, 11193.474 Da.
peptide, polymer, 18 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: virus Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
HIV-1_TAR/KP-Z-41: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
peptide: RVRCRQRKGRRICIRIXP
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 275 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA/RNA (47-MER) | 1 |
| 2 | peptide | 2 |
Entities:
Entity 1, DNA/RNA (47-MER) 29 residues - 11193.474 Da.
| 1 | G | G | C | A | G | A | U | C | U | G | ||||
| 2 | A | G | C | C | U | G | G | G | A | G | ||||
| 3 | C | U | C | U | C | U | G | C | C |
Entity 2, peptide 18 residues - Formula weight is not available
| 1 | ARG | VAL | ARG | CYS | ARG | GLN | ARG | LYS | GLY | ARG | ||||
| 2 | ARG | ILE | CYS | ILE | ARG | ILE | DPR | PRO |