BMRB Entry 16980
Click here to enlarge.
PDB ID: 2kyd
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR16980
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Tolbert, Blanton; Miyazaki, Yasuyuki; Barton, Shawn; Kinde, Benyam; Starck, Patrice; Singh, Rashmi; Bax, Ad; Case, David; Summers, Michael. "Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on refinement." J. Biomol. NMR 47, 205-219 (2010).
PubMed: 20549304
Assembly members:
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'), polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Murine leukemia virus Taxonomy ID: 11786 Superkingdom: not available Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'): GCGGUACUAGUUAGCUAACU
AGCUUUGUA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 77 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_1 | 1 |
| 2 | RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_2 | 1 |
Entities:
Entity 1, RNA (5'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3')_1 29 residues - Formula weight is not available
| 1 | G | C | G | G | U | A | C | U | A | G | ||||
| 2 | U | U | A | G | C | U | A | A | C | U | ||||
| 3 | A | G | C | U | U | U | G | U | A |