BMRB Entry 17188
Click here to enlarge.
PDB ID: 2l3e
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17188
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Zhang, Qi; Kim, Nak-Kyoon; Peterson, Robert; Wang, Zhonghua; Feigon, Juli. "Inaugural Article: Structurally conserved five nucleotide bulge determines the overall topology of the core domain of human telomerase RNA." Proc. Natl. Acad. Sci. U.S.A. 107, 18761-18768 (2010).
PubMed: 20966348
Assembly members:
RNA_35-MER, polymer, 35 residues, 11164.710 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: reverse transcriptase
Entity Sequences (FASTA):
RNA_35-MER: GGCUUUUGCUCCCCGUGCUU
CGGCACGGAAAAGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 235 |
| 15N chemical shifts | 61 |
| 1H chemical shifts | 309 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (35-MER) | 1 |
Entities:
Entity 1, RNA (35-MER) 35 residues - 11164.710 Da.
| 1 | G | G | C | U | U | U | U | G | C | U | ||||
| 2 | C | C | C | C | G | U | G | C | U | U | ||||
| 3 | C | G | G | C | A | C | G | G | A | A | ||||
| 4 | A | A | G | C | C |