Click here to enlarge.
PDB ID: 2lc8
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17601
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Houck-Loomis, Brian; Durney, Michael; Salguero, Carolina; Shankar, Neelaabh; Nagle, Julia; Goff, Stephen. "An equilibrium-dependent retroviral mRNA switch regulates translational recoding." Nature 480, 561-564 (2011).
PubMed: 22121021
Assembly members:
RNA_(59-MER), polymer, 63 residues, 111.103 Da.
Natural source: Common Name: MMLV Taxonomy ID: 11801 Superkingdom: Viruses Kingdom: not available Genus/species: not available murine leukemia virus
Experimental source: Production method: recombinant technology Host organism: None: in vitro transcription Vector: pUC19
Entity Sequences (FASTA):
RNA_(59-MER): GGAGGUCAGGGUCAGGAGCC
CCCCCCUGAACCCAGGAUAA
CCCUCAAAGUCGGGGGGCAA
CCC
Data type | Count |
13C chemical shifts | 92 |
1H chemical shifts | 182 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA_(59-MER) | 1 |
Entity 1, RNA_(59-MER) 63 residues - 111.103 Da.
1 | G | G | A | G | G | U | C | A | G | G | ||||
2 | G | U | C | A | G | G | A | G | C | C | ||||
3 | C | C | C | C | C | C | U | G | A | A | ||||
4 | C | C | C | A | G | G | A | U | A | A | ||||
5 | C | C | C | U | C | A | A | A | G | U | ||||
6 | C | G | G | G | G | G | G | C | A | A | ||||
7 | C | C | C |