BMRB Entry 17941
Click here to enlarge.
PDB ID: 2ljj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17941
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ihle, Yvonne. "The Structure of Subdomain IV-B from the CVB-3 IRES" .
Assembly members:
IV-B_RNA, polymer, 27 residues, 8600.216 Da.
Natural source: Common Name: Coxsackievirus B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B
Experimental source: Production method: enzymatic semisynthesis Vector: pUC19
Entity Sequences (FASTA):
IV-B_RNA: GGCCUCAGCACUACCCCAGU
GUAGGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 179 |
| 15N chemical shifts | 47 |
| 1H chemical shifts | 243 |
| 31P chemical shifts | 2 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | IV-B_RNA | 1 |
Entities:
Entity 1, IV-B_RNA 27 residues - 8600.216 Da.
Residues 290-292 and 314-316 are non-native and were attached facilitating transcription and purification.
| 1 | G | G | C | C | U | C | A | G | C | A | ||||
| 2 | C | U | A | C | C | C | C | A | G | U | ||||
| 3 | G | U | A | G | G | U | C |