Click here to enlarge.
PDB ID: 4a4u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18035
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Zhao, Qin; Huang, Hung-Chung; Nagaswamy, Uma; Xia, Youlin; Gao, Xiaolian; Fox, George. "UNAC tetraloops: to what extent do they mimic GNRA tetraloops?" Biopolymers 97, 617-628 (2012).
PubMed: 22605553
Assembly members:
UGAC, polymer, 22 residues, 7132.18842 Da.
Natural source: Common Name: Haloarcula marismortui Taxonomy ID: 2238 Superkingdom: Archaea Kingdom: not available Genus/species: Haloarcula marismortui
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
UGAC: GGACCCGGCUGACGCUGGGU
CC
Data type | Count |
1H chemical shifts | 88 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | UGAC | 1 |
Entity 1, UGAC 22 residues - 7132.18842 Da.
1 | G | G | A | C | C | C | G | G | C | U | ||||
2 | G | A | C | G | C | U | G | G | G | U | ||||
3 | C | C |