Click here to enlarge.
PDB ID: 2lpw
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18279
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Amrane, Samir; Adrian, Michael; Heddi, Brahim; Serero, Alexandre; Nicolas, Alain; Mergny, Jean-Louis; Phan, Anh Tuan. "Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite." J. Am. Chem. Soc. 134, 5807-5816 (2012).
PubMed: 22376028
Assembly members:
DNA_(26-MER), polymer, 26 residues, 8275.375 Da.
Natural source: Common Name: Humans Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(26-MER): AAGGGTGGGTGTAAGTGTGG
GTGGGT
Data type | Count |
13C chemical shifts | 56 |
1H chemical shifts | 233 |
31P chemical shifts | 25 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | DNA (26-MER) | 1 |
Entity 1, DNA (26-MER) 26 residues - 8275.375 Da.
1 | DA | DA | DG | DG | DG | DT | DG | DG | DG | DT | ||||
2 | DG | DT | DA | DA | DG | DT | DG | DT | DG | DG | ||||
3 | DG | DT | DG | DG | DG | DT |