BMRB Entry 18336
Click here to enlarge.
PDB ID: 2lqz
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18336
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Harjes, Elena; Kitamura, Aya; Zhao, Wei; Morais, Marc; Jardine, Paul; Grimes, Shelley; Matsuo, Hiroshi. "Structure of the RNA claw of the DNA packaging motor of bacteriophage 29." Nucleic Acids Res. 40, 9953-9963 (2012).
PubMed: 22879380
Assembly members:
RNA_(27-MER), polymer, 27 residues, 8586.186 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: Phi 29
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA_(27-MER): GGACUUCCAUUGCUUCGGCA
AAAGUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 69 |
| 15N chemical shifts | 9 |
| 1H chemical shifts | 209 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (27-MER) | 1 |
Entities:
Entity 1, RNA (27-MER) 27 residues - 8586.186 Da.
| 1 | G | G | A | C | U | U | C | C | A | U | ||||
| 2 | U | G | C | U | U | C | G | G | C | A | ||||
| 3 | A | A | A | G | U | C | C |