BMRB Entry 18503
Click here to enlarge.
PDB ID: 2lu0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18503
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Donghi, Daniela; Pechlaner, Maria; Finazzo, Cinzia; Knobloch, Bernd; Sigel, Roland. "The structural stabilization of the three-way junction by Mg(II) represents the first step in the folding of a group II intron." Nucleic Acids Res. 41, 2489-2504 (2013).
PubMed: 23275550
Assembly members:
RNA_(49-MER), polymer, 49 residues, 15800.554 Da.
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis Host organism: cell free synthesis (using T7 polymerase)
Entity Sequences (FASTA):
RNA_(49-MER): GGAAUAUGCUCAACGAAAGU
GAAUCAGCUUCGGCUGAGAG
CUAAGUUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 312 |
| 15N chemical shifts | 95 |
| 1H chemical shifts | 550 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (49-MER) | 1 |
Entities:
Entity 1, RNA (49-MER) 49 residues - 15800.554 Da.
This construct represents residues 195-218 and 374-386 of group II intron ai5(gamma); residues 1,2,48 and 49 as well as residues 27-34 are additions that are not present in the intron.
| 1 | G | G | A | A | U | A | U | G | C | U | ||||
| 2 | C | A | A | C | G | A | A | A | G | U | ||||
| 3 | G | A | A | U | C | A | G | C | U | U | ||||
| 4 | C | G | G | C | U | G | A | G | A | G | ||||
| 5 | C | U | A | A | G | U | U | C | C |