BMRB Entry 18532
Click here to enlarge.
PDB ID: 2lun
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18532
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "An RNA Aptamer Takes an Unexpected Twist to Bind r-Protein S8" Unknown ., .-..
Assembly members:
RNA, polymer, 28 residues, 111.103 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA: GGGCAGUGAUGCUUCGGCAU
AUCAGCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 201 |
| 15N chemical shifts | 65 |
| 1H chemical shifts | 195 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA, 1 | 1 |
| 2 | RNA, 2 | 1 |
| 3 | RNA, 3 | 1 |
| 4 | RNA, 4 | 1 |
| 5 | RNA, 5 | 1 |
| 6 | RNA, 6 | 1 |
| 7 | RNA, 7 | 1 |
| 8 | RNA, 8 | 1 |
| 9 | RNA, 9 | 1 |
Entities:
Entity 1, RNA, 1 28 residues - 111.103 Da.
| 1 | G | G | G | C | A | G | U | G | A | U | ||||
| 2 | G | C | U | U | C | G | G | C | A | U | ||||
| 3 | A | U | C | A | G | C | C | C |