BMRB Entry 18549
Click here to enlarge.
PDB ID: 2lv0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18549
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Moran, Sean; Donarski, James; Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of Helix-35 Stem-loop from E. coli 23S rRNA" .
Assembly members:
RNA, polymer, 24 residues, 132.116 Da.
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA: GGGCUAAUGUUGAAAAAUUA
GCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 181 |
| 15N chemical shifts | 42 |
| 1H chemical shifts | 185 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA | 1 |
Entities:
Entity 1, RNA 24 residues - 132.116 Da.
| 1 | G | G | G | C | U | A | A | U | G | U | ||||
| 2 | U | G | A | A | A | A | A | U | U | A | ||||
| 3 | G | C | C | C |