Click here to enlarge.
PDB ID: 2m21
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18891
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Richards, Rebecca; Wu, Haihong; Trantirek, Lukas; O'Connor, Catherine; Collins, Kathleen; Feigon, Juli. "Solution structure of the Tetrahymena telomerase RNA stem IV terminal loop" RNA 12, 1475-1485 (2006).
PubMed: 16809815
Assembly members:
stemIV_telo_RNA, polymer, 21 residues, 6650.027 Da.
Natural source: Common Name: tetrahymena thermophila Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: tetrahymena thermophila
Experimental source: Production method: enzymatic synthesis Host organism: n/a
Entity Sequences (FASTA):
stemIV_telo_RNA: GGCGAUACACUAUUUAUCGC
C
Data type | Count |
13C chemical shifts | 141 |
15N chemical shifts | 19 |
1H chemical shifts | 181 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | stemIV_telo_RNA | 1 |
Entity 1, stemIV_telo_RNA 21 residues - 6650.027 Da.
1 | G | G | C | G | A | U | A | C | A | C | ||||
2 | U | A | U | U | U | A | U | C | G | C | ||||
3 | C |