Click here to enlarge.
PDB ID: 2m22
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18892
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Richards, Rebecca; Theimer, Carla; Finger, David; Feigon, Juli. "Solution structure of the helix II template boundary element from Tetrahymena telomerase RNA" Nucleic Acids Res. 34, 816-825 (2006).
PubMed: 16452301
Assembly members:
helixII_telo_RNA, polymer, 23 residues, 7387.508 Da.
Natural source: Common Name: tetrahymena thermophila Taxonomy ID: 5911 Superkingdom: Eukaryota Kingdom: not available Genus/species: tetrahymena thermophila
Experimental source: Production method: enzymatic synthesis Host organism: n/a
Entity Sequences (FASTA):
helixII_telo_RNA: GGCAGAUCUGUAAUAGAACU
GCC
Data type | Count |
13C chemical shifts | 151 |
15N chemical shifts | 34 |
1H chemical shifts | 184 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | helixII_telo_RNA | 1 |
Entity 1, helixII_telo_RNA 23 residues - 7387.508 Da.
1 | G | G | C | A | G | A | U | C | U | G | ||||
2 | U | A | A | U | A | G | A | A | C | U | ||||
3 | G | C | C |