BMRB Entry 19018
Click here to enlarge.
PDB ID: 2m4q
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19018
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Tsai, Albert; Uemura, Sotaro; Johansson, Magnus; Puglisi, Elisabetta Viani; Marshall, R. Andrew; Aitken, Colin Echeverria; Korlach, Jonas; Ehrenberg, Mans; Puglisi, Joseph. "The impact of aminoglycosides on the dynamics of translation elongation." Cell Rep. 3, 497-508 (2013).
PubMed: 23416053
Assembly members:
RNA, polymer, 27 residues, 132.116 Da.
APRAMYCIN, non-polymer, 539.577 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA: GGCGUCACACCUUCGGGUGA
AGUCGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 151 |
| 15N chemical shifts | 8 |
| 1H chemical shifts | 214 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA | 1 |
| 2 | APRAMYCIN_1 | 2 |
| 3 | APRAMYCIN_2 | 2 |
| 4 | APRAMYCIN_3 | 2 |
Entities:
Entity 1, RNA 27 residues - 132.116 Da.
| 1 | G | G | C | G | U | C | A | C | A | C | ||||
| 2 | C | U | U | C | G | G | G | U | G | A | ||||
| 3 | A | G | U | C | G | C | C |
Entity 2, APRAMYCIN_1 - C21 H41 N5 O11 - 539.577 Da.
| 1 | AM2 |