Click here to enlarge.
PDB ID: 2m57
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19039
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pechlaner, Maria; Donghi, Daniela; Zelenay, Veronika; Sigel, Roland K. O.. "Acid-base equilibria near neutral pH in the catalytic triad and the bulge of domain 5 of a bacterial group II intron" .
Assembly members:
RNA_(35-MER), polymer, 35 residues, 11268.784 Da.
Natural source: Common Name: Azotobacter vinelandii Taxonomy ID: 354 Superkingdom: Bacteria Kingdom: not available Genus/species: Azotobacter vinelandii
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
RNA_(35-MER): GGAGCCGUAUGCGGUAGUUC
CGCACGUACGGAUCU
Data type | Count |
13C chemical shifts | 216 |
15N chemical shifts | 95 |
1H chemical shifts | 569 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (35-MER) | 1 |
Entity 1, RNA (35-MER) 35 residues - 11268.784 Da.
The sequence corresponds to residues 1836 to 1870 from group II intron 5 of A. vinelandii (numbering includes the open reading frame).
1 | G | G | A | G | C | C | G | U | A | U | ||||
2 | G | C | G | G | U | A | G | U | U | C | ||||
3 | C | G | C | A | C | G | U | A | C | G | ||||
4 | G | A | U | C | U |