Click here to enlarge.
PDB ID: 2miy
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19698
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kang, Mijeong; Eichhorn, Catherine; Feigon, Juli. "Structural determinants for ligand capture by a class II preQ1 riboswitch." Proc. Natl. Acad. Sci. U.S.A. 111, E663-E671 (2014).
PubMed: 24469808
Assembly members:
RNA_(59-MER), polymer, 59 residues, 18903.389 Da.
7-DEAZA-7-AMINOMETHYL-GUANINE, non-polymer, 179.179 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(59-MER): GCUUGGUGCUUAGCUUCUUU
CACCAAGCAUAUUACACGCG
GAUAACCGCCAAAGGAGAA
Data type | Count |
13C chemical shifts | 399 |
15N chemical shifts | 20 |
1H chemical shifts | 620 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (59-MER) | 1 |
2 | 7-DEAZA-7-AMINOMETHYL-GUANINE | 2 |
Entity 1, RNA (59-MER) 59 residues - 18903.389 Da.
1 | G | C | U | U | G | G | U | G | C | U | ||||
2 | U | A | G | C | U | U | C | U | U | U | ||||
3 | C | A | C | C | A | A | G | C | A | U | ||||
4 | A | U | U | A | C | A | C | G | C | G | ||||
5 | G | A | U | A | A | C | C | G | C | C | ||||
6 | A | A | A | G | G | A | G | A | A |
Entity 2, 7-DEAZA-7-AMINOMETHYL-GUANINE - 179.179 Da.
1 | PRF |