Click here to enlarge.
PDB ID: 2n4y
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25686
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: de Nicola, Beatrice; Lech, Christopher Jacques; Regmi, Sagar; Heddi, Brahim; Richter, Sara; Phan, Anh Tuan. "Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome" Nucleic Acids Res. 44, 6442-6451 (2016).
PubMed: 27298260
Assembly members:
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'), polymer, 22 residues, 6945.505 Da.
Natural source: Common Name: viruses Taxonomy ID: 12721 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3'): CTGGGCGGGACTGGGGAGTG
GT
Data type | Count |
1H chemical shifts | 209 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3') | 1 |
Entity 1, DNA (5'-D(*CP*TP*GP*GP*GP*CP*GP*GP*GP*AP*CP*TP*GP*GP*GP*GP*AP*GP*TP*GP*GP*T)-3') 22 residues - 6945.505 Da.
1 | DC | DT | DG | DG | DG | DC | DG | DG | DG | DA | ||||
2 | DC | DT | DG | DG | DG | DG | DA | DG | DT | DG | ||||
3 | DG | DT |