BMRB Entry 25780
Click here to enlarge.
PDB ID: 2n6s
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25780
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis" Nucleic Acids Res. 44, 9426-9437 (2016).
PubMed: 27369378
Assembly members:
RNA_(36-MER), polymer, 36 residues, 11474.870 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
RNA_(36-MER): GGAAUUUAUGAGUACCUUCG
GAUACUUAUAGAUUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 76 |
| 15N chemical shifts | 17 |
| 1H chemical shifts | 215 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (36-MER) | 1 |
Entities:
Entity 1, RNA (36-MER) 36 residues - 11474.870 Da.
| 1 | G | G | A | A | U | U | U | A | U | G | ||||
| 2 | A | G | U | A | C | C | U | U | C | G | ||||
| 3 | G | A | U | A | C | U | U | A | U | A | ||||
| 4 | G | A | U | U | C | C |