Click here to enlarge.
PDB ID: 2n7x
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25826
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chen, Yu; Zubovic, Lorena; Yang, Fan; Godin, Katherine; Pavelitz, Tom; Castellanos, Javier; Macchi, Paolo; Varani, Gabriele. "Rbfox proteins regulate microRNA biogenesis by sequence-specific binding to their precursors and target downstream Dicer" Nucleic Acids Res. 44, 4381-4395 (2016).
PubMed: 27001519
Assembly members:
miR-20b, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: T7 in vitro transcription Host organism: NA Vector: NA
Entity Sequences (FASTA):
miR-20b: GGUAGUUUUGGCAUGACUCU
ACC
Data type | Count |
13C chemical shifts | 153 |
1H chemical shifts | 175 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | miR-20b | 1 |
Entity 1, miR-20b 23 residues - Formula weight is not available
1 | G | G | U | A | G | U | U | U | U | G | ||||
2 | G | C | A | U | G | A | C | U | C | U | ||||
3 | A | C | C |