Click here to enlarge.
PDB ID: 2nc0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25999
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Imai, Shunsuke; Hellen, Christopher; D'Souza, Victoria; Wagner, Gerhard. "An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation" Nat. Struct. Mol. Biol. 23, 859-864 (2016).
PubMed: 27525590
Assembly members:
RNA_(28-MER), polymer, 28 residues, 9128.561 Da.
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus not available
Experimental source: Production method: enzymatic semisynthesis Host organism: Escherichia coli Vector: pUC19
Entity Sequences (FASTA):
RNA_(28-MER): GGGCUGAAGGAUGGAGACGU
CUAGGCCC
Data type | Count |
13C chemical shifts | 164 |
1H chemical shifts | 188 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (28-MER) | 1 |
Entity 1, RNA (28-MER) 28 residues - 9128.561 Da.
1 | G | G | G | C | U | G | A | A | G | G | ||||
2 | A | U | G | G | A | G | A | C | G | U | ||||
3 | C | U | A | G | G | C | C | C |