Click here to enlarge.
PDB ID: 2nci
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26024
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Gu, Xiaobo; Park, Sun-Young; Tonelli, Marco; Cornilescu, Gabriel; Xia, Tianbing; Zhong, Dongping; Schroeder, Susan. "NMR Structures and Dynamics in a Prohead RNA Loop that Binds Metal Ions" J. Phys. Chem. Lett. ., 3841-3846 (2016).
PubMed: 27631837
Assembly members:
RNA_(28-MER), polymer, 28 residues, 8970.434 Da.
Natural source: Common Name: bacteriophage Taxonomy ID: 38018 Superkingdom: Viruses Kingdom: not available Genus/species: not available unidentified phage
Experimental source: Production method: enzymatic semisynthesis Host organism: Transcription of RNA using T7 polymerase Vector: Transcription of RNA using T7 polymerase
Entity Sequences (FASTA):
RNA_(28-MER): GGACGUUAAAAGGCUUCGGC
CUACGUCC
Data type | Count |
13C chemical shifts | 78 |
15N chemical shifts | 11 |
1H chemical shifts | 184 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (28-MER) | 1 |
Entity 1, RNA (28-MER) 28 residues - 8970.434 Da.
1 | G | G | A | C | G | U | U | A | A | A | ||||
2 | A | G | G | C | U | U | C | G | G | C | ||||
3 | C | U | A | C | G | U | C | C |