BMRB Entry 27144
Click here to enlarge.
PDB ID: 5w77
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27144
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chen, Xiang; Walters, Kylie. "DNA with compounds" Nat. Commun. 9, .-. (2018).
Assembly members:
c-Myc_Pu22, polymer, 22 residues, Formula weight is not available
4-[(azepan-1-yl)methyl]-5-hydroxy-2-methyl-N-[4-(trifluoromethyl)phenyl]-1-benzofuran-3-carboxamide, non-polymer, 446.462 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: obtained from a collaborator Host organism: N/A
Entity Sequences (FASTA):
c-Myc_Pu22: TGAGGGTGGGTAGGGTGGGT
AA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 207 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | c-Myc Pu22 | 1 |
| 2 | DC34, 1 | 2 |
| 3 | DC34, 2 | 2 |
Entities:
Entity 1, c-Myc Pu22 22 residues - Formula weight is not available
22 nt of DNA with two compounds
| 1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
| 2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DT | ||||
| 3 | DA | DA |
Entity 2, DC34, 1 - C24 H25 F3 N2 O3 - 446.462 Da.
| 1 | 9WP |