Click here to enlarge.
PDB ID: 5j6u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30058
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dvorkin, Scarlett; Karsisiotis, Andreas; Webba da Silva, Mateus. "Encoding canonical DNA quadruplex structure." Sci Adv 4, eaat3007-eaat3007 (2018).
PubMed: 30182059
Assembly members:
DNA (25-MER), polymer, 25 residues, 7978.100 Da.
Natural source: Common Name: not available Taxonomy ID: 32644 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA (25-MER): GGGGTTTGGGGTTTTGGGGA
AGGGG
Data type | Count |
1H chemical shifts | 256 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 25 residues - 7978.100 Da.
1 | DG | DG | DG | DG | DT | DT | DT | DG | DG | DG | ||||
2 | DG | DT | DT | DT | DT | DG | DG | DG | DG | DA | ||||
3 | DA | DG | DG | DG | DG |