Click here to enlarge.
PDB ID: 5kh8
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30108
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Zhao, Bo; Guffy, Sharon; Williams, Benfeard; Zhang, Qi. "An excited state underlies gene regulation of a transcriptional riboswitch" Nat. Chem. Biol. 13, 968-974 (2017).
PubMed: 28719589
Assembly members:
riboswitch (47-MER), polymer, 47 residues, 15053.960 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
riboswitch (47-MER): GGCGAUGGUGUUCGCCAUAA
ACGCUCUUCGGAGCUAAUGA
CACCUAC
Data type | Count |
13C chemical shifts | 240 |
15N chemical shifts | 19 |
1H chemical shifts | 289 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 47 residues - 15053.960 Da.
1 | G | G | C | G | A | U | G | G | U | G | ||||
2 | U | U | C | G | C | C | A | U | A | A | ||||
3 | A | C | G | C | U | C | U | U | C | G | ||||
4 | G | A | G | C | U | A | A | U | G | A | ||||
5 | C | A | C | C | U | A | C |