Click here to enlarge.
PDB ID: 5kqe
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30132
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Y.; Yesselman, J.; Zhang, Q.; Kang, M.; Feigon, J.. "Structural conservation in the template/pseudoknot domain of vertebrate telomerase RNA from teleost fish to human" Proc. Natl. Acad. Sci. U. S. A. 113, E5125-E5134 (2016).
PubMed: 27531956
Assembly members:
entity_1, polymer, 36 residues, 11464.795 Da.
Natural source: Common Name: Japanese medaka Taxonomy ID: 8090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Oryzias latipes
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGUGUACUUAACGUUUGCU
UCGGCAAACUACAUCC
Data type | Count |
13C chemical shifts | 206 |
15N chemical shifts | 37 |
1H chemical shifts | 272 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 36 residues - 11464.795 Da.
1 | G | G | G | U | G | U | A | C | U | U | ||||
2 | A | A | C | G | U | U | U | G | C | U | ||||
3 | U | C | G | G | C | A | A | A | C | U | ||||
4 | A | C | A | U | C | C |