BMRB Entry 30224
Click here to enlarge.
PDB ID: 5uf3
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30224
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chang, A.; Tran, M.; Nikonowicz, E.. "Structure and Dynamics of the Tetra-A Loop and (A-A)-U Sequence Motif within the Coliphage GA Replicase RNA Operator" Biochemistry 56, 2690-2700 (2017).
PubMed: 28488852
Assembly members:
phage GA operator RNA hairpin, polymer, 23 residues, 7394.496 Da.
Natural source: Common Name: Enterobacteria phage GA Taxonomy ID: 12018 Superkingdom: Viruses Kingdom: not available Genus/species: Levivirus Escherichia virus BZ13
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
phage GA operator RNA hairpin: GGACAUAAGGAAAACCUAUG
UCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 158 |
| 15N chemical shifts | 49 |
| 1H chemical shifts | 196 |
| 31P chemical shifts | 21 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 23 residues - 7394.496 Da.
| 1 | G | G | A | C | A | U | A | A | G | G | ||||
| 2 | A | A | A | A | C | C | U | A | U | G | ||||
| 3 | U | C | C |