Click here to enlarge.
PDB ID: 5uzt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30257
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Shortridge, M.; Walker, M.; Pavelitz, T.; Chen, Y.; Yang, W.; Varani, G.. "A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing." ACS Chem. Biol. 12, 1611-1620 (2017).
PubMed: 28437065
Assembly members:
entity_1, polymer, 31 residues, 9912.896 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUGUUGACUGUUGAAUCUC
AUGGCAACACC
Data type | Count |
13C chemical shifts | 129 |
1H chemical shifts | 180 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 31 residues - 9912.896 Da.
1 | G | G | U | G | U | U | G | A | C | U | ||||
2 | G | U | U | G | A | A | U | C | U | C | ||||
3 | A | U | G | G | C | A | A | C | A | C | ||||
4 | C |